chr4-109913149-TTCAGAAGGTCTCTCAGTTGAAGAAAGAGCTTGGAGGACAACAGCACAACAGGAGAGTAAAAGATGCCCCAGGGCTGAGGCCTCCGCTCAGGCAGCCGCATCTGGGGTCAATCATACTCACCTTGCCCGGGCCATGCTCCAGCAAAATCAAGCTGTTTTCTTTTGAAAGTTCAAACTCATCAAGATTATGCTGCTCACTCTTATCATTCTGTTGCCAGTAGTTTCAAAATTTAGTTTTGTTAGTCTCTCAGCACCGCAGCACTGGAGCTGTCC-T

Variant names:

• chr4-109913149-TTCAGAAGGTCTCTCAGTTGAAGAAAGAGCTTGGAGGACAACAGCACAACAGGAGAGTAAAAGATGCCCCAGGGCTGAGGCCTCCGCTCAGGCAGCCGCATCTGGGGTCAATCATACTCACCTTGCCCGGGCCATGCTCCAGCAAAATCAAGCTGTTTTCTTTTGAAAGTTCAAACTCATCAAGATTATGCTGCTCACTCTTATCATTCTGTTGCCAGTAGTTTCAAAATTTAGTTTTGTTAGTCTCTCAGCACCGCAGCACTGGAGCTGTCC-T
• NM_001963.6:c.-185_87del

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The ENST00000503392.1(EGF):​c.-185_87del variant causes a 5 prime UTR truncation, exon loss change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: EGF ENST00000503392.1 5_prime_UTR_truncation, exon_loss
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 5.36
• Publications: 0 publications found

Genes affected

EGF (HGNC:3229): (epidermal growth factor) This gene encodes a member of the epidermal growth factor superfamily. The encoded preproprotein is proteolytically processed to generate the 53-amino acid epidermal growth factor peptide. This protein acts a potent mitogenic factor that plays an important role in the growth, proliferation and differentiation of numerous cell types. This protein acts by binding with high affinity to the cell surface receptor, epidermal growth factor receptor. Defects in this gene are the cause of hypomagnesemia type 4. Dysregulation of this gene has been associated with the growth and progression of certain cancers. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]

EGF Gene-Disease associations (from GenCC):

• familial primary hypomagnesemia with normocalciuria and normocalcemia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• renal hypomagnesemia 4

  Inheritance: Unknown, AR, AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000503392.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EGF	NM_001963.6	MANE Select	c.-185_87del	p.Met1fs	frameshift start_lost	Exon 1 of 24	NP_001954.2	P01133-1
	EGF	NM_001963.6	MANE Select	c.-185_87del		5_prime_UTR	Exon 1 of 24	NP_001954.2	P01133-1
	EGF	NM_001178130.3		c.-185_87del	p.Met1fs	frameshift start_lost	Exon 1 of 23	NP_001171601.1	P01133-3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EGF	ENST00000265171.10	TSL:1 MANE Select	c.-185_87del	p.Met1fs	frameshift start_lost	Exon 1 of 24	ENSP00000265171.5	P01133-1
	EGF	ENST00000503392.1	TSL:1	c.-185_87del	p.Met1fs	frameshift start_lost	Exon 1 of 23	ENSP00000421384.1	P01133-3
	EGF	ENST00000503392.1	TSL:1	c.-185_87del		5_prime_UTR_truncation exon_loss	Exon 1 of 23	ENSP00000421384.1	P01133-3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr4-110834305;