chr4-109913149-TTCAGAAGGTCTCTCAGTTGAAGAAAGAGCTTGGAGGACAACAGCACAACAGGAGAGTAAAAGATGCCCCAGGGCTGAGGCCTCCGCTCAGGCAGCCGCATCTGGGGTCAATCATACTCACCTTGCCCGGGCCATGCTCCAGCAAAATCAAGCTGTTTTCTTTTGAAAGTTCAAACTCATCAAGATTATGCTGCTCACTCTTATCATTCTGTTGCCAGTAGTTTCAAAATTTAGTTTTGTTAGTCTCTCAGCACCGCAGCACTGGAGCTGTCC-T

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1PM2

The NM_001963.6(EGF):​c.-185_87del variant causes a start lost, 5 prime UTR change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

EGF
NM_001963.6 start_lost, 5_prime_UTR

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 5.36
Variant links:
Genes affected
EGF (HGNC:3229): (epidermal growth factor) This gene encodes a member of the epidermal growth factor superfamily. The encoded preproprotein is proteolytically processed to generate the 53-amino acid epidermal growth factor peptide. This protein acts a potent mitogenic factor that plays an important role in the growth, proliferation and differentiation of numerous cell types. This protein acts by binding with high affinity to the cell surface receptor, epidermal growth factor receptor. Defects in this gene are the cause of hypomagnesemia type 4. Dysregulation of this gene has been associated with the growth and progression of certain cancers. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 10 ACMG points.

PVS1
Start lost variant, no new inframe start found.
PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE UniProt
EGFNM_001963.6 linkuse as main transcriptc.-185_87del start_lost, 5_prime_UTR_variant 1/24 ENST00000265171.10
EGFNM_001178130.3 linkuse as main transcriptc.-185_87del start_lost, 5_prime_UTR_variant 1/23
EGFNM_001178131.3 linkuse as main transcriptc.-185_87del start_lost, 5_prime_UTR_variant 1/23
EGFNM_001357021.2 linkuse as main transcriptc.-185_87del start_lost, 5_prime_UTR_variant 1/20

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Appris UniProt
EGFENST00000265171.10 linkuse as main transcriptc.-185_87del start_lost, 5_prime_UTR_variant 1/241 NM_001963.6 P1P01133-1
EGFENST00000503392.1 linkuse as main transcript coding_sequence_variant, 5_prime_UTR_variant 1/231 P01133-3
EGFENST00000509793.5 linkuse as main transcriptc.-185_87del start_lost, 5_prime_UTR_variant 1/232 P01133-2
EGFENST00000652245.1 linkuse as main transcriptc.-185_87del start_lost, 5_prime_UTR_variant 1/20

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not provided Uncertain:1
Uncertain significance, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpOct 28, 2023This sequence change affects the initiator methionine of the EGF mRNA. The next in-frame methionine is located at codon 79. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with EGF-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr4-110834305; API