chr4-109913149-TTCAGAAGGTCTCTCAGTTGAAGAAAGAGCTTGGAGGACAACAGCACAACAGGAGAGTAAAAGATGCCCCAGGGCTGAGGCCTCCGCTCAGGCAGCCGCATCTGGGGTCAATCATACTCACCTTGCCCGGGCCATGCTCCAGCAAAATCAAGCTGTTTTCTTTTGAAAGTTCAAACTCATCAAGATTATGCTGCTCACTCTTATCATTCTGTTGCCAGTAGTTTCAAAATTTAGTTTTGTTAGTCTCTCAGCACCGCAGCACTGGAGCTGTCC-T

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_001963.6(EGF):​c.-185_87del​(p.Met1fs) variant causes a frameshift, start lost change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

EGF
NM_001963.6 frameshift, start_lost

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 5.36

Publications

0 publications found
Variant links:
Genes affected
EGF (HGNC:3229): (epidermal growth factor) This gene encodes a member of the epidermal growth factor superfamily. The encoded preproprotein is proteolytically processed to generate the 53-amino acid epidermal growth factor peptide. This protein acts a potent mitogenic factor that plays an important role in the growth, proliferation and differentiation of numerous cell types. This protein acts by binding with high affinity to the cell surface receptor, epidermal growth factor receptor. Defects in this gene are the cause of hypomagnesemia type 4. Dysregulation of this gene has been associated with the growth and progression of certain cancers. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]
EGF Gene-Disease associations (from GenCC):
  • familial primary hypomagnesemia with normocalciuria and normocalcemia
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • renal hypomagnesemia 4
    Inheritance: AD, Unknown Classification: LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
EGFNM_001963.6 linkc.-185_87del p.Met1fs frameshift_variant, start_lost Exon 1 of 24 ENST00000265171.10 NP_001954.2 P01133-1
EGFNM_001963.6 linkc.-185_87del 5_prime_UTR_variant Exon 1 of 24 ENST00000265171.10 NP_001954.2 P01133-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
EGFENST00000265171.10 linkc.-185_87del p.Met1fs frameshift_variant, start_lost Exon 1 of 24 1 NM_001963.6 ENSP00000265171.5 P01133-1
EGFENST00000265171.10 linkc.-185_87del 5_prime_UTR_variant Exon 1 of 24 1 NM_001963.6 ENSP00000265171.5 P01133-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not provided Uncertain:1
Oct 28, 2023
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This sequence change affects the initiator methionine of the EGF mRNA. The next in-frame methionine is located at codon 79. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with EGF-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
5.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

hg19: chr4-110834305; API