4-185144767-CAGCATGCCAGCAAACAGATCAG-C

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1PP5

The NM_001151.4(SLC25A4):​c.116_137delAGCATGCCAGCAAACAGATCAG​(p.Gln39LeufsTer14) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

SLC25A4
NM_001151.4 frameshift

Scores

Not classified

Clinical Significance

Pathogenic no assertion criteria provided P:1

Conservation

PhyloP100: 10.0

Publications

1 publications found
Variant links:
Genes affected
SLC25A4 (HGNC:10990): (solute carrier family 25 member 4) This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein forms a homodimer embedded in the inner mitochondria membrane. Mutations in this gene have been shown to result in autosomal dominant progressive external opthalmoplegia and familial hypertrophic cardiomyopathy. [provided by RefSeq, Jun 2013]
SLC25A4 Gene-Disease associations (from GenCC):
  • mitochondrial disease
    Inheritance: AR Classification: DEFINITIVE Submitted by: G2P
  • mitochondrial DNA depletion syndrome 12B (cardiomyopathic type), autosomal recessive
    Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae)
  • Fontaine progeroid syndrome
    Inheritance: AD Classification: STRONG Submitted by: G2P
  • mitochondrial DNA depletion syndrome 12A (cardiomyopathic type), autosomal dominant
    Inheritance: AD Classification: STRONG, MODERATE Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
  • progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 2
    Inheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
  • autosomal dominant progressive external ophthalmoplegia
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • Sengers syndrome
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • Leigh syndrome
    Inheritance: AD Classification: LIMITED Submitted by: ClinGen

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 4-185144767-CAGCATGCCAGCAAACAGATCAG-C is Pathogenic according to our data. Variant chr4-185144767-CAGCATGCCAGCAAACAGATCAG-C is described in ClinVar as [Pathogenic]. Clinvar id is 268149.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
SLC25A4NM_001151.4 linkc.116_137delAGCATGCCAGCAAACAGATCAG p.Gln39LeufsTer14 frameshift_variant Exon 2 of 4 ENST00000281456.11 NP_001142.2 P12235A0A0S2Z3H3

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
SLC25A4ENST00000281456.11 linkc.116_137delAGCATGCCAGCAAACAGATCAG p.Gln39LeufsTer14 frameshift_variant Exon 2 of 4 1 NM_001151.4 ENSP00000281456.5 P12235
SLC25A4ENST00000491736.1 linkn.116_137delAGCATGCCAGCAAACAGATCAG non_coding_transcript_exon_variant Exon 2 of 4 5 ENSP00000476711.1 V9GYG0

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: no assertion criteria provided
LINK: link

Submissions by phenotype

Mitochondrial DNA depletion syndrome 12B (cardiomyopathic type), autosomal recessive Pathogenic:1
Nov 14, 2016
OMIM
Significance:Pathogenic
Review Status:no assertion criteria provided
Collection Method:literature only

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
10
Mutation Taster
=3/197
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs886041080; hg19: chr4-186065921; API