NM_001151.4:c.116_137delAGCATGCCAGCAAACAGATCAG
Variant summary
Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1PP5
The NM_001151.4(SLC25A4):c.116_137delAGCATGCCAGCAAACAGATCAG(p.Gln39LeufsTer14) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001151.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- mitochondrial diseaseInheritance: AR Classification: DEFINITIVE Submitted by: G2P
- mitochondrial DNA depletion syndrome 12B (cardiomyopathic type), autosomal recessiveInheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae)
- Fontaine progeroid syndromeInheritance: AD Classification: STRONG Submitted by: G2P
- mitochondrial DNA depletion syndrome 12A (cardiomyopathic type), autosomal dominantInheritance: AD Classification: STRONG, MODERATE Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 2Inheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
- autosomal dominant progressive external ophthalmoplegiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Sengers syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- Leigh syndromeInheritance: AD Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 9 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
SLC25A4 | NM_001151.4 | c.116_137delAGCATGCCAGCAAACAGATCAG | p.Gln39LeufsTer14 | frameshift_variant | Exon 2 of 4 | ENST00000281456.11 | NP_001142.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
SLC25A4 | ENST00000281456.11 | c.116_137delAGCATGCCAGCAAACAGATCAG | p.Gln39LeufsTer14 | frameshift_variant | Exon 2 of 4 | 1 | NM_001151.4 | ENSP00000281456.5 | ||
SLC25A4 | ENST00000491736.1 | n.116_137delAGCATGCCAGCAAACAGATCAG | non_coding_transcript_exon_variant | Exon 2 of 4 | 5 | ENSP00000476711.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Mitochondrial DNA depletion syndrome 12B (cardiomyopathic type), autosomal recessive Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at