rs886041080

Variant names:

• chr4-185144767-CAGCATGCCAGCAAACAGATCAG-C
• rs886041080
• NM_001151.4:c.116_137delAGCATGCCAGCAAACAGATCAG

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_001151.4(SLC25A4):​c.116_137delAGCATGCCAGCAAACAGATCAG​(p.Gln39LeufsTer14) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: SLC25A4 NM_001151.4 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 10.0
• Publications: 1 publications found

Genes affected

SLC25A4 (HGNC:10990): (solute carrier family 25 member 4) This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein forms a homodimer embedded in the inner mitochondria membrane. Mutations in this gene have been shown to result in autosomal dominant progressive external opthalmoplegia and familial hypertrophic cardiomyopathy. [provided by RefSeq, Jun 2013]

SLC25A4 Gene-Disease associations (from GenCC):

• mitochondrial disease

  Inheritance: AR Classification: DEFINITIVE Submitted by: G2P
• mitochondrial DNA depletion syndrome 12B (cardiomyopathic type), autosomal recessive

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae)
• Fontaine progeroid syndrome

  Inheritance: AD Classification: STRONG Submitted by: G2P
• mitochondrial DNA depletion syndrome 12A (cardiomyopathic type), autosomal dominant

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 2

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• autosomal dominant progressive external ophthalmoplegia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Sengers syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• Leigh syndrome

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 4-185144767-CAGCATGCCAGCAAACAGATCAG-C is Pathogenic according to our data. Variant chr4-185144767-CAGCATGCCAGCAAACAGATCAG-C is described in ClinVar as [Pathogenic]. Clinvar id is 268149.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SLC25A4	NM_001151.4	c.116_137delAGCATGCCAGCAAACAGATCAG	p.Gln39LeufsTer14	frameshift_variant	Exon 2 of 4	ENST00000281456.11	NP_001142.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SLC25A4	ENST00000281456.11	c.116_137delAGCATGCCAGCAAACAGATCAG	p.Gln39LeufsTer14	frameshift_variant	Exon 2 of 4	1	NM_001151.4	ENSP00000281456.5
SLC25A4	ENST00000491736.1	n.116_137delAGCATGCCAGCAAACAGATCAG		non_coding_transcript_exon_variant	Exon 2 of 4	5		ENSP00000476711.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Mitochondrial DNA depletion syndrome 12B (cardiomyopathic type), autosomal recessive Pathogenic:1

Nov 14, 2016

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		10
Mutation Taster		=3/197	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs886041080; hg19: chr4-186065921;