rs886041080

Positions:

• chr4-185144767-CAGCATGCCAGCAAACAGATCAG-C

Variant summary

Our verdict is Pathogenic. Variant got 11 ACMG points: 11P and 0B. PVS1 PM2 PP5

The NM_001151.4(SLC25A4):​c.116_137delAGCATGCCAGCAAACAGATCAG​(p.Gln39fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: SLC25A4 NM_001151.4 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 10.0

Genes affected

SLC25A4 (HGNC:10990): (solute carrier family 25 member 4) This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein forms a homodimer embedded in the inner mitochondria membrane. Mutations in this gene have been shown to result in autosomal dominant progressive external opthalmoplegia and familial hypertrophic cardiomyopathy. [provided by RefSeq, Jun 2013]

ACMG classification

Verdict is Pathogenic. Variant got 11 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 4-185144767-CAGCATGCCAGCAAACAGATCAG-C is Pathogenic according to our data. Variant chr4-185144767-CAGCATGCCAGCAAACAGATCAG-C is described in ClinVar as [Pathogenic]. Clinvar id is 268149.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
SLC25A4	NM_001151.4	c.116_137delAGCATGCCAGCAAACAGATCAG	p.Gln39fs	frameshift_variant	2/4	ENST00000281456.11	NP_001142.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
SLC25A4	ENST00000281456.11	c.116_137delAGCATGCCAGCAAACAGATCAG	p.Gln39fs	frameshift_variant	2/4	1	NM_001151.4	ENSP00000281456.5
SLC25A4	ENST00000491736.1	n.116_137delAGCATGCCAGCAAACAGATCAG		non_coding_transcript_exon_variant	2/4	5		ENSP00000476711.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Mitochondrial DNA depletion syndrome 12B (cardiomyopathic type), autosomal recessive Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Nov 14, 2016

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs886041080; hg19: chr4-186065921;