4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Benign. Variant got -11 ACMG points: 0P and 11B. BP3 BP6_Moderate BS1 BS2

The NM_001388492.1(HTT):c.99_110dup(p.Gln35_Gln38dup) variant causes a inframe insertion change. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.027 (75 hom., cov: 0)
  • Exomes 𝑓: 0.010 (164 hom.)
• Consequence: HTT NM_001388492.1 inframe_insertion
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 4.84

Genes affected

HTT (HGNC:4851): (huntingtin) Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -11 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001388492.1
• BP6: Variant 4-3074876-C-CCAGCAGCAGCAG is Benign according to our data. Variant chr4-3074876-C-CCAGCAGCAGCAG is described in ClinVar as [Benign]. Clinvar id is 1690808.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS1: Variant frequency is greater than expected in population amr. gnomad4 allele frequency = 0.0266 (3503/131854) while in subpopulation AMR AF= 0.0397 (532/13404). AF 95% confidence interval is 0.0369. There are 75 homozygotes in gnomad4. There are 1672 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High Homozygotes in GnomAd at 75 AD,AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
HTT	NM_001388492.1	c.99_110dup	p.Gln35_Gln38dup	inframe_insertion	1/67	ENST00000355072.11
HTT	NM_002111.8	c.99_110dup	p.Gln35_Gln38dup	inframe_insertion	1/67

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
HTT	ENST00000355072.11	c.99_110dup	p.Gln35_Gln38dup	inframe_insertion	1/67	1	NM_001388492.1	P2

Frequencies

GnomAD3 genomes AF: 0.0265 AC: 3497 AN: 131756 Hom.: 75 Cov.: 0

Gnomad AFR AF: 0.0150

Gnomad AMI AF: 0.0439

Gnomad AMR AF: 0.0395

Gnomad ASJ AF: 0.0166

Gnomad EAS AF: 0.00701

Gnomad SAS AF: 0.0189

Gnomad FIN AF: 0.0271

Gnomad MID AF: 0.0187

Gnomad NFE AF: 0.0323

Gnomad OTH AF: 0.0301

GnomAD4 exome AF: 0.0103 AC: 12565 AN: 1225544 Hom.: 164 Cov.: 0 AF XY: 0.0111 AC XY: 6749 AN XY: 608000

Gnomad4 AFR exome AF: 0.00581

Gnomad4 AMR exome AF: 0.0250

Gnomad4 ASJ exome AF: 0.0128

Gnomad4 EAS exome AF: 0.00385

Gnomad4 SAS exome AF: 0.0115

Gnomad4 FIN exome AF: 0.0238

Gnomad4 NFE exome AF: 0.00929

Gnomad4 OTH exome AF: 0.0136

GnomAD4 genome AF: 0.0266 AC: 3503 AN: 131854 Hom.: 75 Cov.: 0 AF XY: 0.0264 AC XY: 1672 AN XY: 63404

Gnomad4 AFR AF: 0.0150

Gnomad4 AMR AF: 0.0397

Gnomad4 ASJ AF: 0.0166

Gnomad4 EAS AF: 0.00703

Gnomad4 SAS AF: 0.0194

Gnomad4 FIN AF: 0.0271

Gnomad4 NFE AF: 0.0323

Gnomad4 OTH AF: 0.0297

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

See cases Benign:1

Benign, criteria provided, single submitter

clinical testing

Laboratorio de Genetica e Diagnostico Molecular, Hospital Israelita Albert Einstein

Feb 16, 2020

ACMG classification criteria: BA1 -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs71180116; hg19: chr4-3076603;