4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Benign. Variant got -10 ACMG points: 0P and 10B. BP3 BP6 BS1 BS2

The NM_001388492.1(HTT):c.96_110dup(p.Gln34_Gln38dup) variant causes a inframe insertion change. Variant has been reported in ClinVar as Likely benign (no stars).

• Frequency:
  • Genomes: 𝑓 0.021 (67 hom., cov: 0)
  • Exomes 𝑓: 0.0076 (69 hom.)
• Consequence: HTT NM_001388492.1 inframe_insertion
• Clinical Significance: Benign/Likely benign no assertion criteria provided B:2
• Conservation: PhyloP100: 4.84

Genes affected

HTT (HGNC:4851): (huntingtin) Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -10 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001388492.1
• BP6: Variant 4-3074876-C-CCAGCAGCAGCAGCAG is Benign according to our data. Variant chr4-3074876-C-CCAGCAGCAGCAGCAG is described in ClinVar as [Likely_benign]. Clinvar id is 1174947.Status of the report is no_assertion_criteria_provided, 0 stars.
• BS1: Variant frequency is greater than expected in population nfe. gnomad4 allele frequency = 0.0212 (2796/131872) while in subpopulation NFE AF= 0.027 (1659/61480). AF 95% confidence interval is 0.0259. There are 67 homozygotes in gnomad4. There are 1274 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High Homozygotes in GnomAd at 67 AD,AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
HTT	NM_001388492.1	c.96_110dup	p.Gln34_Gln38dup	inframe_insertion	1/67	ENST00000355072.11
HTT	NM_002111.8	c.96_110dup	p.Gln34_Gln38dup	inframe_insertion	1/67

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
HTT	ENST00000355072.11	c.96_110dup	p.Gln34_Gln38dup	inframe_insertion	1/67	1	NM_001388492.1	P2

Frequencies

GnomAD3 genomes AF: 0.0212 AC: 2796 AN: 131774 Hom.: 67 Cov.: 0

Gnomad AFR AF: 0.0126

Gnomad AMI AF: 0.0425

Gnomad AMR AF: 0.0259

Gnomad ASJ AF: 0.0125

Gnomad EAS AF: 0.0104

Gnomad SAS AF: 0.0187

Gnomad FIN AF: 0.0170

Gnomad MID AF: 0.00373

Gnomad NFE AF: 0.0270

Gnomad OTH AF: 0.0145

GnomAD4 exome AF: 0.00763 AC: 9353 AN: 1225532 Hom.: 69 Cov.: 0 AF XY: 0.00806 AC XY: 4897 AN XY: 607938

Gnomad4 AFR exome AF: 0.00488

Gnomad4 AMR exome AF: 0.0159

Gnomad4 ASJ exome AF: 0.00849

Gnomad4 EAS exome AF: 0.00512

Gnomad4 SAS exome AF: 0.00806

Gnomad4 FIN exome AF: 0.0148

Gnomad4 NFE exome AF: 0.00711

Gnomad4 OTH exome AF: 0.00961

GnomAD4 genome AF: 0.0212 AC: 2796 AN: 131872 Hom.: 67 Cov.: 0 AF XY: 0.0201 AC XY: 1274 AN XY: 63422

Gnomad4 AFR AF: 0.0126

Gnomad4 AMR AF: 0.0259

Gnomad4 ASJ AF: 0.0125

Gnomad4 EAS AF: 0.0104

Gnomad4 SAS AF: 0.0187

Gnomad4 FIN AF: 0.0170

Gnomad4 NFE AF: 0.0270

Gnomad4 OTH AF: 0.0143

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:2

Revision: no assertion criteria provided

Submissions by phenotype

not specified Benign:1

Benign, no assertion criteria provided

clinical testing

Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen

-

- -

not provided Benign:1

Likely benign, no assertion criteria provided

clinical testing

Genome Diagnostics Laboratory, University Medical Center Utrecht

-

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs71180116; hg19: chr4-3076603;