4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Likely benign. Variant got -6 ACMG points: 0P and 6B. BP3 BS1_Supporting BS2

The NM_001388492.1(HTT):c.93_110dup(p.Gln33_Gln38dup) variant causes a inframe insertion change. Variant has been reported in ClinVar as Uncertain significance (no stars).

• Frequency:
  • Genomes: 𝑓 0.013 (33 hom., cov: 0)
  • Exomes 𝑓: 0.0045 (47 hom.)
• Consequence: HTT NM_001388492.1 inframe_insertion
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 4.84

Genes affected

HTT (HGNC:4851): (huntingtin) Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Likely_benign. Variant got -6 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001388492.1
• BS1: Variant frequency is greater than expected in population amr. gnomad4 allele frequency = 0.0132 (1745/131866) while in subpopulation AMR AF= 0.0199 (267/13410). AF 95% confidence interval is 0.0179. There are 33 homozygotes in gnomad4. There are 882 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck. Existence of Clinvar submissions makes me limit the strength of this signal to Supporting
• BS2: High Homozygotes in GnomAd at 33 AD,AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
HTT	NM_001388492.1	c.93_110dup	p.Gln33_Gln38dup	inframe_insertion	1/67	ENST00000355072.11
HTT	NM_002111.8	c.93_110dup	p.Gln33_Gln38dup	inframe_insertion	1/67

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
HTT	ENST00000355072.11	c.93_110dup	p.Gln33_Gln38dup	inframe_insertion	1/67	1	NM_001388492.1	P2

Frequencies

GnomAD3 genomes AF: 0.0133 AC: 1747 AN: 131768 Hom.: 33 Cov.: 0

Gnomad AFR AF: 0.0105

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0199

Gnomad ASJ AF: 0.0279

Gnomad EAS AF: 0.00459

Gnomad SAS AF: 0.0115

Gnomad FIN AF: 0.0129

Gnomad MID AF: 0.0149

Gnomad NFE AF: 0.0136

Gnomad OTH AF: 0.0117

GnomAD4 exome AF: 0.00450 AC: 5512 AN: 1225724 Hom.: 47 Cov.: 0 AF XY: 0.00482 AC XY: 2932 AN XY: 608080

Gnomad4 AFR exome AF: 0.00407

Gnomad4 AMR exome AF: 0.00888

Gnomad4 ASJ exome AF: 0.0169

Gnomad4 EAS exome AF: 0.00199

Gnomad4 SAS exome AF: 0.00541

Gnomad4 FIN exome AF: 0.00920

Gnomad4 NFE exome AF: 0.00380

Gnomad4 OTH exome AF: 0.00679

GnomAD4 genome AF: 0.0132 AC: 1745 AN: 131866 Hom.: 33 Cov.: 0 AF XY: 0.0139 AC XY: 882 AN XY: 63416

Gnomad4 AFR AF: 0.0104

Gnomad4 AMR AF: 0.0199

Gnomad4 ASJ AF: 0.0279

Gnomad4 EAS AF: 0.00436

Gnomad4 SAS AF: 0.0113

Gnomad4 FIN AF: 0.0129

Gnomad4 NFE AF: 0.0136

Gnomad4 OTH AF: 0.0116

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: no assertion criteria provided

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, no assertion criteria provided

clinical testing

Department of Pathology and Laboratory Medicine, Sinai Health System

-

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs71180116; hg19: chr4-3076603;