4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Benign. Variant got -9 ACMG points: 0P and 9B. BP3 BS1 BS2

The NM_001388492.1(HTT):c.90_110dup(p.Gln32_Gln38dup) variant causes a inframe insertion change. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.010 (11 hom., cov: 0)
  • Exomes 𝑓: 0.0036 (20 hom.)
• Consequence: HTT NM_001388492.1 inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 4.84

Genes affected

HTT (HGNC:4851): (huntingtin) Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -9 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001388492.1
• BS1: Variant frequency is greater than expected in population nfe. gnomad4 allele frequency = 0.0101 (1333/131868) while in subpopulation NFE AF= 0.0119 (730/61482). AF 95% confidence interval is 0.0112. There are 11 homozygotes in gnomad4. There are 602 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High Homozygotes in GnomAd at 10 AD,AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
HTT	NM_001388492.1	c.90_110dup	p.Gln32_Gln38dup	inframe_insertion	1/67	ENST00000355072.11
HTT	NM_002111.8	c.90_110dup	p.Gln32_Gln38dup	inframe_insertion	1/67

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
HTT	ENST00000355072.11	c.90_110dup	p.Gln32_Gln38dup	inframe_insertion	1/67	1	NM_001388492.1	P2

Frequencies

GnomAD3 genomes AF: 0.0101 AC: 1332 AN: 131770 Hom.: 10 Cov.: 0

Gnomad AFR AF: 0.00833

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0116

Gnomad ASJ AF: 0.00816

Gnomad EAS AF: 0.00314

Gnomad SAS AF: 0.00793

Gnomad FIN AF: 0.00787

Gnomad MID AF: 0.0112

Gnomad NFE AF: 0.0119

Gnomad OTH AF: 0.0117

GnomAD4 exome AF: 0.00357 AC: 4374 AN: 1225744 Hom.: 20 Cov.: 0 AF XY: 0.00383 AC XY: 2330 AN XY: 608074

Gnomad4 AFR exome AF: 0.00260

Gnomad4 AMR exome AF: 0.00554

Gnomad4 ASJ exome AF: 0.00479

Gnomad4 EAS exome AF: 0.00237

Gnomad4 SAS exome AF: 0.00424

Gnomad4 FIN exome AF: 0.00815

Gnomad4 NFE exome AF: 0.00322

Gnomad4 OTH exome AF: 0.00546

GnomAD4 genome AF: 0.0101 AC: 1333 AN: 131868 Hom.: 11 Cov.: 0 AF XY: 0.00949 AC XY: 602 AN XY: 63418

Gnomad4 AFR AF: 0.00831

Gnomad4 AMR AF: 0.0118

Gnomad4 ASJ AF: 0.00816

Gnomad4 EAS AF: 0.00315

Gnomad4 SAS AF: 0.00742

Gnomad4 FIN AF: 0.00787

Gnomad4 NFE AF: 0.0119

Gnomad4 OTH AF: 0.0116

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs71180116; hg19: chr4-3076603;