4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Benign. Variant got -9 ACMG points: 0P and 9B. BP3 BS1 BS2

The NM_001388492.1(HTT):c.87_110dup(p.Gln31_Gln38dup) variant causes a inframe insertion change. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0070 (4 hom., cov: 0)
  • Exomes 𝑓: 0.0026 (41 hom.)
• Consequence: HTT NM_001388492.1 inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 4.84

Genes affected

HTT (HGNC:4851): (huntingtin) Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -9 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001388492.1
• BS1: Variant frequency is greater than expected in population amr. gnomad4 allele frequency = 0.00701 (924/131880) while in subpopulation AMR AF= 0.00843 (113/13412). AF 95% confidence interval is 0.00754. There are 4 homozygotes in gnomad4. There are 431 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High Homozygotes in GnomAd at 4 AD,AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
HTT	NM_001388492.1	c.87_110dup	p.Gln31_Gln38dup	inframe_insertion	1/67	ENST00000355072.11
HTT	NM_002111.8	c.87_110dup	p.Gln31_Gln38dup	inframe_insertion	1/67

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
HTT	ENST00000355072.11	c.87_110dup	p.Gln31_Gln38dup	inframe_insertion	1/67	1	NM_001388492.1	P2

Frequencies

GnomAD3 genomes AF: 0.00702 AC: 925 AN: 131782 Hom.: 4 Cov.: 0

Gnomad AFR AF: 0.00613

Gnomad AMI AF: 0.00750

Gnomad AMR AF: 0.00851

Gnomad ASJ AF: 0.00533

Gnomad EAS AF: 0.00169

Gnomad SAS AF: 0.00460

Gnomad FIN AF: 0.00394

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00813

Gnomad OTH AF: 0.00947

GnomAD4 exome AF: 0.00259 AC: 3174 AN: 1225730 Hom.: 41 Cov.: 0 AF XY: 0.00271 AC XY: 1646 AN XY: 608074

Gnomad4 AFR exome AF: 0.00225

Gnomad4 AMR exome AF: 0.00383

Gnomad4 ASJ exome AF: 0.00290

Gnomad4 EAS exome AF: 0.00175

Gnomad4 SAS exome AF: 0.00312

Gnomad4 FIN exome AF: 0.00455

Gnomad4 NFE exome AF: 0.00239

Gnomad4 OTH exome AF: 0.00388

GnomAD4 genome AF: 0.00701 AC: 924 AN: 131880 Hom.: 4 Cov.: 0 AF XY: 0.00680 AC XY: 431 AN XY: 63424

Gnomad4 AFR AF: 0.00611

Gnomad4 AMR AF: 0.00843

Gnomad4 ASJ AF: 0.00533

Gnomad4 EAS AF: 0.00170

Gnomad4 SAS AF: 0.00460

Gnomad4 FIN AF: 0.00394

Gnomad4 NFE AF: 0.00813

Gnomad4 OTH AF: 0.00936

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs71180116; hg19: chr4-3076603;