4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Benign. Variant got -11 ACMG points: 0P and 11B. BP3 BP6_Moderate BS1 BS2

The NM_001388492.1(HTT):c.81_110dup(p.Gln29_Gln38dup) variant causes a inframe insertion change. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.0040 (5 hom., cov: 0)
  • Exomes 𝑓: 0.0015 (19 hom.)
  • Failed GnomAD Quality Control
• Consequence: HTT NM_001388492.1 inframe_insertion
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 4.84

Genes affected

HTT (HGNC:4851): (huntingtin) Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -11 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001388492.1
• BP6: Variant 4-3074876-C-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG is Benign according to our data. Variant chr4-3074876-C-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG is described in ClinVar as [Likely_benign]. Clinvar id is 2654593.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS1: Variant frequency is greater than expected in population amr. gnomad4 allele frequency = 0.00405 (534/131868) while in subpopulation AMR AF= 0.00619 (83/13410). AF 95% confidence interval is 0.00511. There are 5 homozygotes in gnomad4. There are 223 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High Homozygotes in GnomAd at 5 AD,AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
HTT	NM_001388492.1	c.81_110dup	p.Gln29_Gln38dup	inframe_insertion	1/67	ENST00000355072.11
HTT	NM_002111.8	c.81_110dup	p.Gln29_Gln38dup	inframe_insertion	1/67

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
HTT	ENST00000355072.11	c.81_110dup	p.Gln29_Gln38dup	inframe_insertion	1/67	1	NM_001388492.1	P2

Frequencies

GnomAD3 genomes AF: 0.00404 AC: 533 AN: 131770 Hom.: 5 Cov.: 0

Gnomad AFR AF: 0.00311

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00620

Gnomad ASJ AF: 0.00313

Gnomad EAS AF: 0.00121

Gnomad SAS AF: 0.00153

Gnomad FIN AF: 0.00149

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00486

Gnomad OTH AF: 0.00501

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00150 AC: 1834 AN: 1225782 Hom.: 19 Cov.: 0 AF XY: 0.00160 AC XY: 976 AN XY: 608110

Gnomad4 AFR exome AF: 0.00132

Gnomad4 AMR exome AF: 0.00330

Gnomad4 ASJ exome AF: 0.00185

Gnomad4 EAS exome AF: 0.00148

Gnomad4 SAS exome AF: 0.00192

Gnomad4 FIN exome AF: 0.00215

Gnomad4 NFE exome AF: 0.00137

Gnomad4 OTH exome AF: 0.00172

GnomAD4 genome AF: 0.00405 AC: 534 AN: 131868 Hom.: 5 Cov.: 0 AF XY: 0.00352 AC XY: 223 AN XY: 63418

Gnomad4 AFR AF: 0.00313

Gnomad4 AMR AF: 0.00619

Gnomad4 ASJ AF: 0.00313

Gnomad4 EAS AF: 0.00121

Gnomad4 SAS AF: 0.00153

Gnomad4 FIN AF: 0.00149

Gnomad4 NFE AF: 0.00486

Gnomad4 OTH AF: 0.00496

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Likely benign, criteria provided, single submitter

clinical testing

CeGaT Center for Human Genetics Tuebingen

Dec 01, 2022

HTT: BS2 -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs71180116; hg19: chr4-3076603;