4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Benign. Variant got -9 ACMG points: 0P and 9B. BP3 BS1 BS2

The NM_001388492.1(HTT):c.75_110dup(p.Gln27_Gln38dup) variant causes a inframe insertion change. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0020 (2 hom., cov: 0)
  • Exomes 𝑓: 0.00079 (15 hom.)
  • Failed GnomAD Quality Control
• Consequence: HTT NM_001388492.1 inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 4.84

Genes affected

HTT (HGNC:4851): (huntingtin) Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -9 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001388492.1
• BS1: Variant frequency is greater than expected in population amr. gnomad4 allele frequency = 0.002 (264/131882) while in subpopulation AMR AF= 0.00373 (50/13412). AF 95% confidence interval is 0.0029. There are 2 homozygotes in gnomad4. There are 128 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High Homozygotes in GnomAd at 2 AD,AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
HTT	NM_001388492.1	c.75_110dup	p.Gln27_Gln38dup	inframe_insertion	1/67	ENST00000355072.11
HTT	NM_002111.8	c.75_110dup	p.Gln27_Gln38dup	inframe_insertion	1/67

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
HTT	ENST00000355072.11	c.75_110dup	p.Gln27_Gln38dup	inframe_insertion	1/67	1	NM_001388492.1	P2

Frequencies

GnomAD3 genomes AF: 0.00200 AC: 263 AN: 131784 Hom.: 2 Cov.: 0

Gnomad AFR AF: 0.00138

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00373

Gnomad ASJ AF: 0.00157

Gnomad EAS AF: 0.000725

Gnomad SAS AF: 0.000511

Gnomad FIN AF: 0.00149

Gnomad MID AF: 0.00373

Gnomad NFE AF: 0.00223

Gnomad OTH AF: 0.00278

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000794 AC: 973 AN: 1225848 Hom.: 15 Cov.: 0 AF XY: 0.000867 AC XY: 527 AN XY: 608152

Gnomad4 AFR exome AF: 0.000659

Gnomad4 AMR exome AF: 0.00165

Gnomad4 ASJ exome AF: 0.000660

Gnomad4 EAS exome AF: 0.000825

Gnomad4 SAS exome AF: 0.000886

Gnomad4 FIN exome AF: 0.00191

Gnomad4 NFE exome AF: 0.000702

Gnomad4 OTH exome AF: 0.00125

GnomAD4 genome AF: 0.00200 AC: 264 AN: 131882 Hom.: 2 Cov.: 0 AF XY: 0.00202 AC XY: 128 AN XY: 63426

Gnomad4 AFR AF: 0.00138

Gnomad4 AMR AF: 0.00373

Gnomad4 ASJ AF: 0.00157

Gnomad4 EAS AF: 0.000727

Gnomad4 SAS AF: 0.000767

Gnomad4 FIN AF: 0.00149

Gnomad4 NFE AF: 0.00223

Gnomad4 OTH AF: 0.00275

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs71180116; hg19: chr4-3076603;