4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP3 BS1

The NM_001388492.1(HTT):c.69_110dup(p.Gln25_Gln38dup) variant causes a inframe insertion change. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00085 (0 hom., cov: 0)
  • Exomes 𝑓: 0.00034 (7 hom.)
  • Failed GnomAD Quality Control
• Consequence: HTT NM_001388492.1 inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 4.84

Genes affected

HTT (HGNC:4851): (huntingtin) Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Likely_benign. Variant got -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001388492.1
• BS1: Variant frequency is greater than expected in population eas. gnomad4 allele frequency = 0.000849 (112/131882) while in subpopulation EAS AF= 0.00097 (4/4124). AF 95% confidence interval is 0.000749. There are 0 homozygotes in gnomad4. There are 58 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
HTT	NM_001388492.1	c.69_110dup	p.Gln25_Gln38dup	inframe_insertion	1/67	ENST00000355072.11
HTT	NM_002111.8	c.69_110dup	p.Gln25_Gln38dup	inframe_insertion	1/67

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
HTT	ENST00000355072.11	c.69_110dup	p.Gln25_Gln38dup	inframe_insertion	1/67	1	NM_001388492.1	P2

Frequencies

GnomAD3 genomes AF: 0.000842 AC: 111 AN: 131784 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000903

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000373

Gnomad ASJ AF: 0.000627

Gnomad EAS AF: 0.000967

Gnomad SAS AF: 0.000511

Gnomad FIN AF: 0.000543

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000943

Gnomad OTH AF: 0.00223

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000339 AC: 416 AN: 1225840 Hom.: 7 Cov.: 0 AF XY: 0.000340 AC XY: 207 AN XY: 608134

Gnomad4 AFR exome AF: 0.000232

Gnomad4 AMR exome AF: 0.000528

Gnomad4 ASJ exome AF: 0.000440

Gnomad4 EAS exome AF: 0.000206

Gnomad4 SAS exome AF: 0.000401

Gnomad4 FIN exome AF: 0.000646

Gnomad4 NFE exome AF: 0.000312

Gnomad4 OTH exome AF: 0.000463

GnomAD4 genome AF: 0.000849 AC: 112 AN: 131882 Hom.: 0 Cov.: 0 AF XY: 0.000914 AC XY: 58 AN XY: 63424

Gnomad4 AFR AF: 0.000929

Gnomad4 AMR AF: 0.000373

Gnomad4 ASJ AF: 0.000627

Gnomad4 EAS AF: 0.000970

Gnomad4 SAS AF: 0.000512

Gnomad4 FIN AF: 0.000543

Gnomad4 NFE AF: 0.000943

Gnomad4 OTH AF: 0.00220

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs71180116; hg19: chr4-3076603;