4-41746002-CGCTGCCGCGGCCGCCGCCGCT-CGCTGCCGCGGCCGCCGCCGCTGCTGCCGCGGCCGCCGCCGCT

Variant names:

• chr4-41746002-C-CGCTGCCGCGGCCGCCGCCGCT
• rs772448418
• NM_003924.4:c.729_749dupAGCGGCGGCGGCCGCGGCAGC

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 2P and 1B. PP5_Moderate BP3

The NM_003924.4(PHOX2B):​c.729_749dupAGCGGCGGCGGCCGCGGCAGC​(p.Ala244_Ala250dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. A250A) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: PHOX2B NM_003924.4 disruptive_inframe_insertion
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: -0.308
• Publications: 0 publications found

Genes affected

PHOX2B (HGNC:9143): (paired like homeobox 2B) The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the nucleus. The protein functions as a transcription factor involved in the development of several major noradrenergic neuron populations and the determination of neurotransmitter phenotype. The gene product is linked to enhancement of second messenger-mediated activation of the dopamine beta-hydroylase, c-fos promoters and several enhancers, including cyclic amp-response element and serum-response element. Expansion of a 20 amino acid polyalanine tract in this protein by 5-13 aa has been associated with congenital central hypoventilation syndrome. [provided by RefSeq, Jul 2016]

PHOX2B Gene-Disease associations (from GenCC):

• central hypoventilation syndrome, congenital, 1, with or without Hirschsprung disease

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen, G2P
• Haddad syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• neuroblastoma, susceptibility to, 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P
• congenital central hypoventilation syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PP5: Variant 4-41746002-C-CGCTGCCGCGGCCGCCGCCGCT is Pathogenic according to our data. Variant chr4-41746002-C-CGCTGCCGCGGCCGCCGCCGCT is described in ClinVar as Pathogenic. ClinVar VariationId is 506167.Status of the report is criteria_provided_single_submitter, 1 stars.
• BP3: Nonframeshift variant in repetitive region in NM_003924.4

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PHOX2B	NM_003924.4	c.729_749dupAGCGGCGGCGGCCGCGGCAGC	p.Ala244_Ala250dup	disruptive_inframe_insertion	Exon 3 of 3	ENST00000226382.4	NP_003915.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PHOX2B	ENST00000226382.4	c.729_749dupAGCGGCGGCGGCCGCGGCAGC	p.Ala244_Ala250dup	disruptive_inframe_insertion	Exon 3 of 3	1	NM_003924.4	ENSP00000226382.2
PHOX2B	ENST00000510424.2	n.*10_*30dupAGCGGCGGCGGCCGCGGCAGC		downstream_gene_variant		3

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Data not reliable, filtered out with message: AC0;AS_VQSR AF: 0.00 AC: 0 AN: 1015758 Hom.: 0 Cov.: 30 AF XY: 0.00 AC XY: 0 AN XY: 484012

African (AFR) AF: 0.00 AC: 0 AN: 20190

American (AMR) AF: 0.00 AC: 0 AN: 6074

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 11022

East Asian (EAS) AF: 0.00 AC: 0 AN: 19072

South Asian (SAS) AF: 0.00 AC: 0 AN: 19392

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 22388

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2618

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 876462

Other (OTH) AF: 0.00 AC: 0 AN: 38540

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Congenital central hypoventilation Pathogenic:1

Oct 02, 2017

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The p.Ala241[27] variant in PHOX2B is a well-established pathogenic variant for CCHS, which has been reported in >200 affected individuals across multiple studi es (Weese-Mayer 2010). This variant is a 21bp duplication within a polyalanine t ract in exon 3 of the PHOX2B gene, resulting in an expansion to a total of 27 al anine residues. It frequently occurs de novo, though autosomal dominant inherita nce and somatic mosaicism have also been reported. In summary, this variant meet s our criteria to be classified as pathogenic for CCHS in an autosomal dominant manner. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.31
Mutation Taster		=76/24	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs772448418; hg19: chr4-41748019;