4-625794-C-CACGGCGCTGCTGGAGCTGGTGCAGGATATGCAGGAGAGCATCAACATGGAGCGCGTGGTCTTCAAGGTCCT
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_000283.4(PDE6B):c.169_239dupACGGCGCTGCTGGAGCTGGTGCAGGATATGCAGGAGAGCATCAACATGGAGCGCGTGGTCTTCAAGGTCCT(p.Leu83fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000205 in 1,461,012 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000283.4 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 12 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
PDE6B | ENST00000496514.6 | c.169_239dupACGGCGCTGCTGGAGCTGGTGCAGGATATGCAGGAGAGCATCAACATGGAGCGCGTGGTCTTCAAGGTCCT | p.Leu83fs | frameshift_variant | 1/22 | 1 | NM_000283.4 | ENSP00000420295.1 | ||
PDE6B | ENST00000255622.10 | c.169_239dupACGGCGCTGCTGGAGCTGGTGCAGGATATGCAGGAGAGCATCAACATGGAGCGCGTGGTCTTCAAGGTCCT | p.Leu83fs | frameshift_variant | 1/22 | 1 | ENSP00000255622.6 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome AF: 0.00000205 AC: 3AN: 1461012Hom.: 0 Cov.: 33 AF XY: 0.00000138 AC XY: 1AN XY: 726854
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
not provided Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Aug 20, 2023 | For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 13108). This premature translational stop signal has been observed in individual(s) with retinitis pigmentosa (PMID: 7599633). This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Leu83Cysfs*91) in the PDE6B gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in PDE6B are known to be pathogenic (PMID: 8394174, 8595886, 22334370). - |
Retinitis pigmentosa 40 Pathogenic:1
Pathogenic, no assertion criteria provided | literature only | OMIM | Jan 01, 1995 | - - |
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at