4-663771-CCCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGA-CTCTGGG

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong

The NM_000283.4(PDE6B):​c.1923_1969delCCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGAinsTCTGGG​(p.Asn643fs) variant causes a frameshift, missense, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Another nucleotide change resulting in same amino acid change has been previously reported as Pathogenicin Lovd. Synonymous variant affecting the same amino acid position (i.e. T641T) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 33)

Consequence

PDE6B
NM_000283.4 frameshift, missense, splice_region

Scores

Not classified

Clinical Significance

Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:9

Conservation

PhyloP100: 8.69
Variant links:
Genes affected
PDE6B (HGNC:8786): (phosphodiesterase 6B) Photon absorption triggers a signaling cascade in rod photoreceptors that activates cGMP phosphodiesterase (PDE), resulting in the rapid hydrolysis of cGMP, closure of cGMP-gated cation channels, and hyperpolarization of the cell. PDE is a peripheral membrane heterotrimeric enzyme made up of alpha, beta, and gamma subunits. This gene encodes the beta subunit. Mutations in this gene result in retinitis pigmentosa and autosomal dominant congenital stationary night blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 18 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 4-663772-CCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGA-TCTGGG is Pathogenic according to our data. Variant chr4-663772-CCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGA-TCTGGG is described in ClinVar as [Likely_pathogenic]. Clinvar id is 224742.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
PDE6BNM_000283.4 linkuse as main transcriptc.1923_1969delCCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGAinsTCTGGG p.Asn643fs frameshift_variant, missense_variant, splice_region_variant 16/22 ENST00000496514.6 NP_000274.3 P35913-1

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
PDE6BENST00000496514.6 linkuse as main transcriptc.1923_1969delCCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGAinsTCTGGG p.Asn643fs frameshift_variant, missense_variant, splice_region_variant 16/221 NM_000283.4 ENSP00000420295.1 P35913-1

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:9
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Retinitis pigmentosa 40 Pathogenic:3
Likely pathogenic, no assertion criteria providedclinical testingCentre for Genomic Medicine, Manchester, Central Manchester University HospitalsMay 12, 2015- -
Pathogenic, no assertion criteria providedclinical testingJoint Genome Diagnostic Labs from Nijmegen and Maastricht, Radboudumc and MUMC+Sep 01, 2016- -
Likely pathogenic, criteria provided, single submitterresearchOcular Genomics Institute, Massachusetts Eye and EarApr 08, 2021The PDE6B c.1923_1969delinsTCTGGG variant was identified in an individual with retinitis pigmentosa with a presumed recessive inheritance pattern. Through a review of available evidence we were able to apply the following criteria: PVS1, PM2. Based on this evidence we have classified this variant as Likely Pathogenic. -
Retinitis pigmentosa Pathogenic:3
Likely pathogenic, no assertion criteria providedresearchDepartment of Clinical Genetics, Copenhagen University Hospital, RigshospitaletApr 01, 2018- -
Likely pathogenic, no assertion criteria providedresearchNIHR Bioresource Rare Diseases, University of CambridgeJan 01, 2015- -
Pathogenic, criteria provided, single submitterresearchMolecular Genetics Laboratory, Institute for Ophthalmic ResearchJan 09, 2020- -
not provided Pathogenic:2
Pathogenic, criteria provided, single submitterclinical testingGeneDxSep 06, 2018The c.1923_1969del47insTCTGGG variant in the PDE6B gene has been reported previously in association with autosomal recessive retinitis pigmentosa when present in the homozygous state or when present with another disease-causing PDE6B variant (Shen et al., 2014; Carss et al., 2017). This variant causes a frameshift starting with codon Asparagine 643, changes this amino acid to a Glycine residue, and creates a premature Stop codon at position 29 of the new reading frame, denoted p.Asn643GlyfsX29. This variant is predicted to cause loss of normal protein function either through protein truncation or nonsense-mediated mRNA decay. This frameshift variant is not observed in large population cohorts (Lek et al., 2016). We interpret c.1923_1969del47insTCTGGG as a pathogenic variant. -
Pathogenic, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpFeb 10, 2022For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 224742). This premature translational stop signal has been observed in individual(s) with inherited autosomal recessive retinal disease (PMID: 26872967, 28041643). This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Asn643Glyfs*29) in the PDE6B gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in PDE6B are known to be pathogenic (PMID: 8394174, 8595886, 22334370). -
PDE6B-related disorder Pathogenic:1
Pathogenic, no assertion criteria providedclinical testingPreventionGenetics, part of Exact SciencesSep 11, 2024The PDE6B c.1923_1969delinsTCTGGG variant is predicted to result in a frameshift and premature protein termination (p.Asn643Glyfs*29). This variant has been reported in the homozygous and compound heterozygous states in individuals with retinal disease (Shen et al. 2014. PubMed ID: 25377065; Table S2, Carss et al. 2016. PubMed ID: 28041643). This variant has not been reported in a large population database (http://gnomad.broadinstitute.org), indicating this variant is rare. Frameshift variants in PDE6B are an established mechanism of disease. This variant is interpreted as pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs869312177; hg19: chr4-657561; API