4-987056-AGCCCCGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGC-A
Variant summary
Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PVS1PS1_ModeratePM2PP5_Moderate
The NM_000203.5(IDUA):c.-23_18delGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGCGCCCC(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Genomes: not found (cov: 33)
Consequence
IDUA
NM_000203.5 frameshift, start_lost
NM_000203.5 frameshift, start_lost
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 0.190
Genes affected
IDUA (HGNC:5391): (alpha-L-iduronidase) This gene encodes an enzyme that hydrolyzes the terminal alpha-L-iduronic acid residues of two glycosaminoglycans, dermatan sulfate and heparan sulfate. This hydrolysis is required for the lysosomal degradation of these glycosaminoglycans. Mutations in this gene that result in enzymatic deficiency lead to the autosomal recessive disease mucopolysaccharidosis type I (MPS I). [provided by RefSeq, Jul 2008]
SLC26A1 (HGNC:10993): (solute carrier family 26 member 1) This gene is a member of a family of sulfate/anion transporter genes. Family members are well conserved in their genomic (number and size of exons) and protein (aa length among species) structures, but have markedly different tissue expression patterns. This gene is primarily expressed in the liver, pancreas, and brain. Three splice variants that encode different isoforms have been identified. [provided by RefSeq, Jul 2008]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 14 ACMG points.
PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 50 pathogenic variants in the truncated region.
PS1
Another start lost variant in NM_000203.5 (IDUA) was described as [Pathogenic] in Lovd
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 4-987056-AGCCCCGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGC-A is Pathogenic according to our data. Variant chr4-987056-AGCCCCGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGC-A is described in ClinVar as [Pathogenic]. Clinvar id is 2866981.Status of the report is criteria_provided_single_submitter, 1 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
IDUA | NM_000203.5 | c.-23_18delGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGCGCCCC | p.Met1fs | frameshift_variant, start_lost | 1/14 | ENST00000514224.2 | NP_000194.2 | |
IDUA | NM_000203.5 | c.-23_18delGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGCGCCCC | 5_prime_UTR_variant | 1/14 | ENST00000514224.2 | NP_000194.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
IDUA | ENST00000514224.2 | c.-23_18delGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGCGCCCC | p.Met1fs | frameshift_variant, start_lost | 1/14 | 2 | NM_000203.5 | ENSP00000425081.2 | ||
IDUA | ENST00000514224 | c.-23_18delGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGCGCCCC | 5_prime_UTR_variant | 1/14 | 2 | NM_000203.5 | ENSP00000425081.2 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 33
GnomAD4 genome
Cov.:
33
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Mucopolysaccharidosis type 1 Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | May 22, 2023 | For these reasons, this variant has been classified as Pathogenic. Disruption of the initiator codon has been observed in individual(s) with mucopolysaccharidosis type I (PMID: 31236806). This variant is not present in population databases (gnomAD no frequency). This sequence change affects the initiator methionine of the IDUA mRNA. The next in-frame methionine is located at codon 133. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
Publications
No publications associated with this variant yet.