4-987056-AGCCCCGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGC-A

Variant names:

• chr4-987056-AGCCCCGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGC-A
• NM_000203.5:c.-23_18delGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGCGCCCC

Variant summary

Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PVS1 PS1_Moderate PM2 PP5_Moderate

The NM_000203.5(IDUA):​c.-23_18delGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGCGCCCC​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: IDUA NM_000203.5 frameshift, start_lost
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 0.190

Genes affected

IDUA (HGNC:5391): (alpha-L-iduronidase) This gene encodes an enzyme that hydrolyzes the terminal alpha-L-iduronic acid residues of two glycosaminoglycans, dermatan sulfate and heparan sulfate. This hydrolysis is required for the lysosomal degradation of these glycosaminoglycans. Mutations in this gene that result in enzymatic deficiency lead to the autosomal recessive disease mucopolysaccharidosis type I (MPS I). [provided by RefSeq, Jul 2008]

SLC26A1 (HGNC:10993): (solute carrier family 26 member 1) This gene is a member of a family of sulfate/anion transporter genes. Family members are well conserved in their genomic (number and size of exons) and protein (aa length among species) structures, but have markedly different tissue expression patterns. This gene is primarily expressed in the liver, pancreas, and brain. Three splice variants that encode different isoforms have been identified. [provided by RefSeq, Jul 2008]

DGKQ (HGNC:2856): (diacylglycerol kinase theta) The protein encoded by this gene contains three cysteine-rich domains, a proline-rich region, and a pleckstrin homology domain with an overlapping Ras-associating domain. It is localized in the speckle domains of the nucleus, and mediates the regeneration of phosphatidylinositol (PI) from diacylglycerol in the PI-cycle during cell signal transduction. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 14 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 50 pathogenic variants in the truncated region.
• PS1: Another start lost variant in NM_000203.5 (IDUA) was described as [Pathogenic] in Lovd
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 4-987056-AGCCCCGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGC-A is Pathogenic according to our data. Variant chr4-987056-AGCCCCGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGC-A is described in ClinVar as [Pathogenic]. Clinvar id is 2866981.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
IDUA	NM_000203.5	c.-23_18delGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGCGCCCC	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 14	ENST00000514224.2	NP_000194.2
IDUA	NM_000203.5	c.-23_18delGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGCGCCCC		5_prime_UTR_variant	Exon 1 of 14	ENST00000514224.2	NP_000194.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
IDUA	ENST00000514224.2	c.-23_18delGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGCGCCCC	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 14	2	NM_000203.5	ENSP00000425081.2
IDUA	ENST00000514224	c.-23_18delGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGCGCCCC		5_prime_UTR_variant	Exon 1 of 14	2	NM_000203.5	ENSP00000425081.2

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Mucopolysaccharidosis type 1 Pathogenic:1

May 22, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. Disruption of the initiator codon has been observed in individual(s) with mucopolysaccharidosis type I (PMID: 31236806). This variant is not present in population databases (gnomAD no frequency). This sequence change affects the initiator methionine of the IDUA mRNA. The next in-frame methionine is located at codon 133. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr4-980844;