NM_000203.5:c.-23_18delGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGCGCCCC
Variant summary
Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1PS1_ModeratePP5_Moderate
The NM_000203.5(IDUA):c.-23_18delGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGCGCCCC(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Consequence
NM_000203.5 frameshift, start_lost
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 12 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
IDUA | NM_000203.5 | c.-23_18delGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGCGCCCC | p.Met1fs | frameshift_variant, start_lost | Exon 1 of 14 | ENST00000514224.2 | NP_000194.2 | |
IDUA | NM_000203.5 | c.-23_18delGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGCGCCCC | 5_prime_UTR_variant | Exon 1 of 14 | ENST00000514224.2 | NP_000194.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
IDUA | ENST00000514224.2 | c.-23_18delGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGCGCCCC | p.Met1fs | frameshift_variant, start_lost | Exon 1 of 14 | 2 | NM_000203.5 | ENSP00000425081.2 | ||
IDUA | ENST00000514224.2 | c.-23_18delGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGCGCCCC | 5_prime_UTR_variant | Exon 1 of 14 | 2 | NM_000203.5 | ENSP00000425081.2 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Mucopolysaccharidosis type 1 Pathogenic:1
For these reasons, this variant has been classified as Pathogenic. Disruption of the initiator codon has been observed in individual(s) with mucopolysaccharidosis type I (PMID: 31236806). This variant is not present in population databases (gnomAD no frequency). This sequence change affects the initiator methionine of the IDUA mRNA. The next in-frame methionine is located at codon 133. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at