chr4-987056-AGCCCCGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGC-A

Variant summary

Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PVS1PS1_ModeratePM2PP5_Moderate

The NM_000203.5(IDUA):​c.-23_18delGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGCGCCCC​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 33)

Consequence

IDUA
NM_000203.5 frameshift, start_lost

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 0.190
Variant links:
Genes affected
IDUA (HGNC:5391): (alpha-L-iduronidase) This gene encodes an enzyme that hydrolyzes the terminal alpha-L-iduronic acid residues of two glycosaminoglycans, dermatan sulfate and heparan sulfate. This hydrolysis is required for the lysosomal degradation of these glycosaminoglycans. Mutations in this gene that result in enzymatic deficiency lead to the autosomal recessive disease mucopolysaccharidosis type I (MPS I). [provided by RefSeq, Jul 2008]
SLC26A1 (HGNC:10993): (solute carrier family 26 member 1) This gene is a member of a family of sulfate/anion transporter genes. Family members are well conserved in their genomic (number and size of exons) and protein (aa length among species) structures, but have markedly different tissue expression patterns. This gene is primarily expressed in the liver, pancreas, and brain. Three splice variants that encode different isoforms have been identified. [provided by RefSeq, Jul 2008]
DGKQ (HGNC:2856): (diacylglycerol kinase theta) The protein encoded by this gene contains three cysteine-rich domains, a proline-rich region, and a pleckstrin homology domain with an overlapping Ras-associating domain. It is localized in the speckle domains of the nucleus, and mediates the regeneration of phosphatidylinositol (PI) from diacylglycerol in the PI-cycle during cell signal transduction. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 14 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 50 pathogenic variants in the truncated region.
PS1
Another start lost variant in NM_000203.5 (IDUA) was described as [Pathogenic] in Lovd
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 4-987056-AGCCCCGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGC-A is Pathogenic according to our data. Variant chr4-987056-AGCCCCGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGC-A is described in ClinVar as [Pathogenic]. Clinvar id is 2866981.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
IDUANM_000203.5 linkc.-23_18delGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGCGCCCC p.Met1fs frameshift_variant, start_lost Exon 1 of 14 ENST00000514224.2 NP_000194.2 P35475-1
IDUANM_000203.5 linkc.-23_18delGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGCGCCCC 5_prime_UTR_variant Exon 1 of 14 ENST00000514224.2 NP_000194.2 P35475-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
IDUAENST00000514224.2 linkc.-23_18delGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGCGCCCC p.Met1fs frameshift_variant, start_lost Exon 1 of 14 2 NM_000203.5 ENSP00000425081.2 P35475-1
IDUAENST00000514224 linkc.-23_18delGCAGTCCCCGAGCACGCGTGGCCATGCGTCCCCTGCGCCCC 5_prime_UTR_variant Exon 1 of 14 2 NM_000203.5 ENSP00000425081.2 P35475-1

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Mucopolysaccharidosis type 1 Pathogenic:1
May 22, 2023
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. Disruption of the initiator codon has been observed in individual(s) with mucopolysaccharidosis type I (PMID: 31236806). This variant is not present in population databases (gnomAD no frequency). This sequence change affects the initiator methionine of the IDUA mRNA. The next in-frame methionine is located at codon 133. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr4-980844; API