5-132680583-AGAAGCAAGATGGCCTGTTGGGAGGCTACCACAGTAAACCAGGCTAGAGATGATGGTGGCGTGGACAGAATGAAGCAAGATGGCCTGTTGGGAGGCTACCACAGTAAACCAGGCTAGAGACGATGGTGGCGTGGACAGAAT-A
Variant summary
Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2
The NM_000589.4(IL4):c.360+765_360+904del variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Genomes: not found (cov: 32)
Consequence
IL4
NM_000589.4 intron
NM_000589.4 intron
Scores
Not classified
Clinical Significance
Not reported in ClinVar
Conservation
PhyloP100: 1.02
Genes affected
IL4 (HGNC:6014): (interleukin 4) The protein encoded by this gene is a pleiotropic cytokine produced by activated T cells. This cytokine is a ligand for interleukin 4 receptor. The interleukin 4 receptor also binds to IL13, which may contribute to many overlapping functions of this cytokine and IL13. STAT6, a signal transducer and activator of transcription, has been shown to play a central role in mediating the immune regulatory signal of this cytokine. This gene, IL3, IL5, IL13, and CSF2 form a cytokine gene cluster on chromosome 5q, with this gene particularly close to IL13. This gene, IL13 and IL5 are found to be regulated coordinately by several long-range regulatory elements in an over 120 kilobase range on the chromosome. IL4 is considered an important cytokine for tissue repair, counterbalancing the effects of proinflammatory type 1 cytokines, however, it also promotes allergic airway inflammation. Moreover, IL-4, a type 2 cytokine, mediates and regulates a variety of human host responses such as allergic, anti-parasitic, wound healing, and acute inflammation. This cytokine has been reported to promote resolution of neutrophil-mediated acute lung injury. In an allergic response, IL-4 has an essential role in the production of allergen-specific immunoglobin (Ig) E. This pro-inflammatory cytokine has been observed to be increased in COVID-19 (Coronavirus disease 2019) patients, but is not necessarily associated with severe COVID-19 pathology. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Aug 2020]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Uncertain_significance. Variant got 2 ACMG points.
PM2
Very rare variant in population databases, with high coverage;
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
IL4 | NM_000589.4 | c.360+765_360+904del | intron_variant | ENST00000231449.7 | NP_000580.1 | |||
IL4 | NM_172348.3 | c.312+765_312+904del | intron_variant | NP_758858.1 | ||||
IL4 | NM_001354990.2 | c.*50+765_*50+904del | intron_variant | NP_001341919.1 | ||||
LOC105379176 | NR_134248.1 | n.177-607_177-468del | intron_variant |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
IL4 | ENST00000231449.7 | c.360+765_360+904del | intron_variant | 1 | NM_000589.4 | ENSP00000231449.2 | ||||
IL4 | ENST00000350025.2 | c.312+765_312+904del | intron_variant | 1 | ENSP00000325190.3 | |||||
IL4 | ENST00000622422.1 | c.*50+765_*50+904del | intron_variant | 1 | ENSP00000480581.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Not reported inComputational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at