5-1393745-TGTGGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCA-TGTGGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGTGGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCA

Position:

• chr5-1393745-TGTGGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCA-TGTGGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGTGGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCA

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 0P and 0B.

The ENST00000270349.12(SLC6A3):​c.*989_*990insTGGAGCGTGTACTACCCCAGGACGCATGCAGGGCCCCCAC variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0000077 (0 hom., cov: 21)
  • Failed GnomAD Quality Control
• Consequence: SLC6A3 ENST00000270349.12 3_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -1.54

Genes affected

SLC6A3 (HGNC:11049): (solute carrier family 6 member 3) This gene encodes a dopamine transporter which is a member of the sodium- and chloride-dependent neurotransmitter transporter family. The 3' UTR of this gene contains a 40 bp tandem repeat, referred to as a variable number tandem repeat or VNTR, which can be present in 3 to 11 copies. Variation in the number of repeats is associated with idiopathic epilepsy, attention-deficit hyperactivity disorder, dependence on alcohol and cocaine, susceptibility to Parkinson disease and protection against nicotine dependence.[provided by RefSeq, Nov 2009]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
SLC6A3	NM_001044.5	c.*989_*990insTGGAGCGTGTACTACCCCAGGACGCATGCAGGGCCCCCAC		3_prime_UTR_variant	15/15	ENST00000270349.12	NP_001035.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
SLC6A3	ENST00000270349.12	c.*989_*990insTGGAGCGTGTACTACCCCAGGACGCATGCAGGGCCCCCAC		3_prime_UTR_variant	15/15	1	NM_001044.5	ENSP00000270349	P1

Frequencies

GnomAD3 genomes AF: 0.00 AC: 1 AN: 130334 Hom.: 0 Cov.: 21 FAILED QC

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000158

Gnomad OTH AF: 0.00

GnomAD4 exome Cov.: 0

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000767 AC: 1 AN: 130334 Hom.: 0 Cov.: 21 AF XY: 0.0000160 AC XY: 1 AN XY: 62316

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000158

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs28363170; hg19: chr5-1393860;