5-1393745-TGTGGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCA-TGTGGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGTGGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCA

Variant names:

• chr5-1393745-T-TGTGGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCA
• rs28363170
• NM_001044.5:c.*950_*989dupTGGAGCGTGTACTACCCCAGGACGCATGCAGGGCCCCCAC

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_001044.5(SLC6A3):​c.*950_*989dupTGGAGCGTGTACTACCCCAGGACGCATGCAGGGCCCCCAC variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0000077 (0 hom., cov: 21)
  • Failed GnomAD Quality Control
• Consequence: SLC6A3 NM_001044.5 3_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -1.54
• Publications: 116 publications found

Genes affected

SLC6A3 (HGNC:11049): (solute carrier family 6 member 3) This gene encodes a dopamine transporter which is a member of the sodium- and chloride-dependent neurotransmitter transporter family. The 3' UTR of this gene contains a 40 bp tandem repeat, referred to as a variable number tandem repeat or VNTR, which can be present in 3 to 11 copies. Variation in the number of repeats is associated with idiopathic epilepsy, attention-deficit hyperactivity disorder, dependence on alcohol and cocaine, susceptibility to Parkinson disease and protection against nicotine dependence.[provided by RefSeq, Nov 2009]

SLC6A3 Gene-Disease associations (from GenCC):

• classic dopamine transporter deficiency syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• SLC6A3-related dopamine transporter deficiency syndrome

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• parkinsonism-dystonia, infantile

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SLC6A3	NM_001044.5	c.*950_*989dupTGGAGCGTGTACTACCCCAGGACGCATGCAGGGCCCCCAC		3_prime_UTR_variant	Exon 15 of 15	ENST00000270349.12	NP_001035.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SLC6A3	ENST00000270349.12	c.*950_*989dupTGGAGCGTGTACTACCCCAGGACGCATGCAGGGCCCCCAC		3_prime_UTR_variant	Exon 15 of 15	1	NM_001044.5	ENSP00000270349.9

Frequencies

GnomAD3 genomes AF: 0.00000767 AC: 1 AN: 130334 Hom.: 0 Cov.: 21

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000158

Gnomad OTH AF: 0.00

GnomAD4 exome Cov.: 0

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000767 AC: 1 AN: 130334 Hom.: 0 Cov.: 21 AF XY: 0.0000160 AC XY: 1 AN XY: 62316

African (AFR) AF: 0.00 AC: 0 AN: 32992

American (AMR) AF: 0.00 AC: 0 AN: 12518

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3292

East Asian (EAS) AF: 0.00 AC: 0 AN: 4286

South Asian (SAS) AF: 0.00 AC: 0 AN: 3858

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 7286

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 224

European-Non Finnish (NFE) AF: 0.0000158 AC: 1 AN: 63242

Other (OTH) AF: 0.00 AC: 0 AN: 1806

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-1.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs28363170; hg19: chr5-1393860;