rs28363170

Variant names:

• chr5-1393745-TGTGGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCA-T
• rs28363170
• NM_001044.5:c.*950_*989delTGGAGCGTGTACTACCCCAGGACGCATGCAGGGCCCCCAC

Your query was ambiguous. Multiple possible variants found:

• chr5-1393745-TGTGGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCA-T
• chr5-1393745-TGTGGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCA-TGTGGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGTGGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCA

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_001044.5(SLC6A3):​c.*950_*989delTGGAGCGTGTACTACCCCAGGACGCATGCAGGGCCCCCAC variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain risk allele (★).

• Frequency: Genomes: 𝑓 0.000054 (0 hom., cov: 20)
• Consequence: SLC6A3 NM_001044.5 3_prime_UTR
• Clinical Significance: Uncertain risk allele criteria provided, single submitter O:1
• Conservation: PhyloP100: 1.63
• Publications: 117 publications found

Genes affected

SLC6A3 (HGNC:11049): (solute carrier family 6 member 3) This gene encodes a dopamine transporter which is a member of the sodium- and chloride-dependent neurotransmitter transporter family. The 3' UTR of this gene contains a 40 bp tandem repeat, referred to as a variable number tandem repeat or VNTR, which can be present in 3 to 11 copies. Variation in the number of repeats is associated with idiopathic epilepsy, attention-deficit hyperactivity disorder, dependence on alcohol and cocaine, susceptibility to Parkinson disease and protection against nicotine dependence.[provided by RefSeq, Nov 2009]

SLC6A3 Gene-Disease associations (from GenCC):

• classic dopamine transporter deficiency syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, PanelApp Australia, Ambry Genetics
• SLC6A3-related dopamine transporter deficiency syndrome

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• parkinsonism-dystonia, infantile

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001044.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SLC6A3	NM_001044.5	MANE Select	c.*950_*989delTGGAGCGTGTACTACCCCAGGACGCATGCAGGGCCCCCAC		3_prime_UTR	Exon 15 of 15	NP_001035.1	Q01959

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SLC6A3	ENST00000270349.12	TSL:1 MANE Select	c.*950_*989delTGGAGCGTGTACTACCCCAGGACGCATGCAGGGCCCCCAC		3_prime_UTR	Exon 15 of 15	ENSP00000270349.9	Q01959
	SLC6A3	ENST00000512002.2	TSL:1	n.*244_*283delTGGAGCGTGTACTACCCCAGGACGCATGCAGGGCCCCCAC		downstream_gene	N/A

Frequencies

GnomAD3 genomes AF: 0.0000537 AC: 7 AN: 130330 Hom.: 0 Cov.: 20

Gnomad AFR AF: 0.0000303

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000799

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000259

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000632

Gnomad OTH AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.0000537 AC: 7 AN: 130370 Hom.: 0 Cov.: 20 AF XY: 0.0000481 AC XY: 3 AN XY: 62376

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000303 AC: 1 AN: 33052

American (AMR) AF: 0.0000798 AC: 1 AN: 12532

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3292

East Asian (EAS) AF: 0.00 AC: 0 AN: 4274

South Asian (SAS) AF: 0.000260 AC: 1 AN: 3844

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 7286

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 210

European-Non Finnish (NFE) AF: 0.0000633 AC: 4 AN: 63234

Other (OTH) AF: 0.00 AC: 0 AN: 1816

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0.0000000515075), which strongly suggests a high chance of mosaicism in these individuals.

ClinVar

ClinVar submissions

Significance: Uncertain risk allele

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Schizophrenia (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs28363170; hg19: chr5-1393860;