rs28363170

chr5-1393745-TGTGGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCA-Tchr5-1393745-TGTGGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCA-TGTGGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGTGGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCA

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_001044.5(SLC6A3):c.*950_*989del variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000537 in 130,370 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain risk allele (★).

• Frequency: Genomes: 𝑓 0.000054 (0 hom., cov: 20)
• Consequence: SLC6A3 NM_001044.5 3_prime_UTR
• Clinical Significance: Uncertain risk allele criteria provided, single submitter O:1
• Conservation: PhyloP100: 1.63

Genes affected

SLC6A3 (HGNC:11049): (solute carrier family 6 member 3) This gene encodes a dopamine transporter which is a member of the sodium- and chloride-dependent neurotransmitter transporter family. The 3' UTR of this gene contains a 40 bp tandem repeat, referred to as a variable number tandem repeat or VNTR, which can be present in 3 to 11 copies. Variation in the number of repeats is associated with idiopathic epilepsy, attention-deficit hyperactivity disorder, dependence on alcohol and cocaine, susceptibility to Parkinson disease and protection against nicotine dependence.[provided by RefSeq, Nov 2009]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
SLC6A3	NM_001044.5	c.*950_*989del		3_prime_UTR_variant	15/15	ENST00000270349.12

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
SLC6A3	ENST00000270349.12	c.*950_*989del		3_prime_UTR_variant	15/15	1	NM_001044.5	P1

Frequencies

GnomAD3 genomes AF: 0.0000537 AC: 7 AN: 130330 Hom.: 0 Cov.: 20

Gnomad AFR AF: 0.0000303

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000799

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000259

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000632

Gnomad OTH AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.0000537 AC: 7 AN: 130370 Hom.: 0 Cov.: 20 AF XY: 0.0000481 AC XY: 3 AN XY: 62376

Gnomad4 AFR AF: 0.0000303

Gnomad4 AMR AF: 0.0000798

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000260

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000633

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Uncertain risk allele

Submissions summary: Other:1

Revision: criteria provided, single submitter

Submissions by phenotype

Schizophrenia Other:1

Uncertain risk allele, criteria provided, single submitter

case-control

Center for Forensic Mental Health, Chiba University

-

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs28363170; hg19: chr5-1393860;