5-140114160-CGCGGCAGCGGAGCGCAGCATCATGGCGGACCGAGACA-C

Position:

• chr5-140114160-CGCGGCAGCGGAGCGCAGCATCATGGCGGACCGAGACA-C

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_005859.5(PURA):​c.-12_25delGAGCGCAGCATCATGGCGGACCGAGACAGCGGCAGCG​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: PURA NM_005859.5 frameshift, start_lost
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 3.21

Genes affected

PURA (HGNC:9701): (purine rich element binding protein A) This gene product is a sequence-specific, single-stranded DNA-binding protein. It binds preferentially to the single strand of the purine-rich element termed PUR, which is present at origins of replication and in gene flanking regions in a variety of eukaryotes from yeasts through humans. Thus, it is implicated in the control of both DNA replication and transcription. Deletion of this gene has been associated with myelodysplastic syndrome and acute myelogenous leukemia. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 23 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 5-140114160-CGCGGCAGCGGAGCGCAGCATCATGGCGGACCGAGACA-C is Pathogenic according to our data. Variant chr5-140114160-CGCGGCAGCGGAGCGCAGCATCATGGCGGACCGAGACA-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 974857.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
PURA	NM_005859.5	c.-12_25delGAGCGCAGCATCATGGCGGACCGAGACAGCGGCAGCG	p.Met1fs	frameshift_variant, start_lost	1/1	ENST00000331327.5	NP_005850.1
PURA	NM_005859.5	c.-12_25delGAGCGCAGCATCATGGCGGACCGAGACAGCGGCAGCG		5_prime_UTR_variant	1/1	ENST00000331327.5	NP_005850.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
PURA	ENST00000331327.5	c.-12_25delGAGCGCAGCATCATGGCGGACCGAGACAGCGGCAGCG	p.Met1fs	frameshift_variant, start_lost	1/1	6	NM_005859.5	ENSP00000332706.3
PURA	ENST00000331327	c.-12_25delGAGCGCAGCATCATGGCGGACCGAGACAGCGGCAGCG		5_prime_UTR_variant	1/1		NM_005859.5	ENSP00000332706.3

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Centogene AG - the Rare Disease Company

-

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1763033823; hg19: chr5-139493745;