PURA

purine rich element binding protein A

Basic information

Region (hg38): 5:140107777-140125619

Links

ENSG00000185129 ∙ NCBI:5813 ∙ OMIM:600473 ∙ HGNC:9701 ∙ Uniprot:Q00577 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• intellectual disability, autosomal dominant 40 (Definitive), mode of inheritance: AD
• PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome due to a point mutation (Supportive), mode of inheritance: AD
• PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome due to a point mutation (Strong), mode of inheritance: AD
• complex neurodevelopmental disorder (Definitive), mode of inheritance: AD

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Neurodevelopmental disorder with neonatal respiratory insufficiency, hypotonia, and feeding difficulties	AD	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Craniofacial; Endocrine; Neurologic	25342064; 25439098; 25533962

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the PURA gene.

• PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome (60 variants)
• not provided (38 variants)
• Inborn genetic diseases (14 variants)
• PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome due to a point mutation (4 variants)
• PURA Syndrome (3 variants)
• Intellectual disability (2 variants)
• Epileptic encephalopathy (1 variants)
• Global developmental delay;Intellectual disability;Neonatal hypotonia;Seizure;Delayed speech and language development (1 variants)
• PURA-related disorder (1 variants)
• Intellectual disability;Neonatal hypotonia;Delayed speech and language development;Global developmental delay (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the PURA gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			17	132	4	153
missense	9	31	81	15	4	140
nonsense	22	9	1			32
start loss	5	2				7
frameshift	67	21				88
inframe indel	2	6	23	23		54
splice donor/acceptor (+/-2bp)						0
splice region						0
non coding			1		1	2
Total	105	69	123	170	9

Highest pathogenic variant AF is 0.0000197

Variants in PURA

This is a list of pathogenic ClinVar variants found in the PURA region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
5-140113537-CGCATGAGAGGGGGTGGCCGTGACTCGGTGTCCCCTCTTTGCAGGGGGCTCTGCTGCGCCGCGCAGGCCCCTCCTCCTACATCCTCTTTGGGGGGTCACTGGAAAGCAGAGCTTAGGCCCACTCTCTGTGCTTAGTATGGCAGACTCCTTCTCACCCCTAGTCCCCTAACTCCCCAGGCCGAGGCCGCCTAGGGTCTGCCCAACAGCGACAGCCACGGTGGTGGTGGTGGTGGTGGTGGTGGTAGCAGTGGTGGCGGCAGCAGCGGCAGCAGCAGCTGCGACGCTGCGCGTCCTGCTCCCTCTCCCCCACCCAGCCAGGGTTGTAGGGTGAGGGCCGGTGGGTGGGCGCCGCCTGGCGGGCGGGCGGACGGGGGGCTGGCAGCGGGGAGGGGGCGCAGGTCACGTGCCGGCGGGCGGGTGGGCGCGTACAGTAGGGCGCCCTGCTACTGTACTGGGGAGTCAGTGCCCTGTTACCGGGTCTCGTCTGTCTCGTCTCTCCCGCAGATCTCGCGAGAGTGGCTGACTGGCTGTGGGGGTTGCGGCGGCAGCAGGCGGAGCCGGGGAGGGAAAGCAGCGGCGGCTGAGGCGACTGAGGCGGCGGGCGGAGCGGCAGGCGGCGGCGGCGCGGCAGCGGAGCGCAGCATCATGGCGGACCGAGACAGCGGCAGCGAGCAGGGTGGTGCGGCGCTGGGTTCGGGCGGCTCCCTGGGGCACCCCGGCTCGGGCTCAGGCTCCGGCGGGGGCGGTGGTGGCGGCGGGGGCGGCGGCGGCAGTGGCGGCGGCGGCGGCGGGGCCCCAGGGGGGCTGCAGCACGAGACGCAGGAGCTGGCCTCCAAGCGGGTGGACATCCAGAACAAGCGCTTCTACCTGGACGTGAAGCAGAACGCCAAGGGCCGCTTCCTGAAGAT-GAGGTGGG		PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome	Pathogenic (May 04, 2023)
5-140114148-AGGCGGCGGCGGCGCGGCAGCGGAGCGCAGCATCATGGCGGACCGAGACAGCGGCAGCGAGCAGGGTGGTGCGGCGCTGGGTTCGGGCGGCTCCCTGGGGCACCCCGGCTCGGGCTCAGGCTCCGGCGGGGGCGGTGGTGGCGGCGGGGGCGGCGGCGGCAGT-A		Inborn genetic diseases	Pathogenic (Nov 22, 2023)
5-140114160-CGCGGCAGCGGAGCGCAGCATCATGGCGGACCGAGACA-C		PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome	Likely pathogenic (-)
5-140114182-A-G		PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome	Pathogenic/Likely pathogenic (Dec 06, 2021)
5-140114182-A-T		PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome	Pathogenic (Aug 26, 2021)
5-140114183-T-C		PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome	Pathogenic (Oct 07, 2022)
5-140114184-G-A		PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome	Pathogenic (May 17, 2022)
5-140114183-T-TGGCG		PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome	Likely pathogenic (Oct 13, 2022)
5-140114184-GGCGGA-G			Pathogenic (Nov 01, 2016)
5-140114185-GCGGAC-G		Inborn genetic diseases	Pathogenic (Dec 01, 2015)
5-140114187-G-C		PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome	Uncertain significance (May 15, 2022)
5-140114187-G-GGACC			Pathogenic (Feb 01, 2019)
5-140114191-C-T		PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome	Pathogenic (Apr 04, 2024)
5-140114194-GAC-G			Likely pathogenic (Jul 13, 2022)
5-140114195-ACAGCGGCAGCG-C			Pathogenic (Sep 13, 2017)
5-140114195-AC-A		PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome	Likely pathogenic (-)
5-140114199-CG-C		PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome	Pathogenic (Sep 28, 2022)
5-140114205-CGAGCAGGGTG-C		PURA-related disorder	Pathogenic (Sep 12, 2023)
5-140114206-G-T		PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome	Pathogenic (Jun 15, 2022)
5-140114208-G-A		PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome	Benign/Likely benign (Nov 07, 2023)
5-140114209-C-T			Pathogenic (May 27, 2022)
5-140114210-A-T		PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome	Uncertain significance (May 18, 2023)
5-140114215-G-T		PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome	Uncertain significance (Jul 06, 2022)
5-140114217-TGCGGCGCTGGGTTCGG-T			Pathogenic (Jul 14, 2016)
5-140114218-GC-G			Pathogenic (Jun 07, 2018)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
PURA	protein_coding	protein_coding	ENST00000331327	1	8960

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.940	0.0595	0	0	0	0	0.00

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	3.37	39	158	0.246	0.00000741	2080
Missense in Polyphen		8	94.151	0.08497		1065
Synonymous	-3.51	110	72.1	1.53	0.00000344	680
Loss of Function	2.77	0	8.93	0.00	3.82e-7	104

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00	0.00
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.00	0.00
European (Non-Finnish)	0.00	0.00
Middle Eastern	0.00	0.00
South Asian	0.00	0.00
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: This is a probable transcription activator that specifically binds the purine-rich single strand of the PUR element located upstream of the MYC gene. May play a role in the initiation of DNA replication and in recombination.
• Disease: DISEASE: Mental retardation, autosomal dominant 31 (MRD31) [MIM:616158]: A disorder characterized by significantly below average general intellectual functioning associated with impairments in adaptive behavior and manifested during the developmental period. MRD31 patients manifest neonatal hypotonia, encephalopathy with or without epilepsy, and severe developmental delay. {ECO:0000269|PubMed:25342064, ECO:0000269|PubMed:25439098}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: miR-targeted genes in epithelium - TarBase;miR-targeted genes in lymphocytes - TarBase;Exercise-induced Circadian Regulation (Consensus)

Recessive Scores

• pRec: 0.200

Intolerance Scores

• rvis_EVS: -0.12
• rvis_percentile_EVS: 44.54

Haploinsufficiency Scores

• pHI: 0.660
• hipred: Y
• hipred_score: 0.783
• ghis: 0.645

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: S
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.925

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Low	Low	Low
Primary Immunodeficiency	Medium	Low	Medium
Cancer	Low	Low	Low

Mouse Genome Informatics

• Gene name: Pura
• Phenotype: nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); immune system phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); respiratory system phenotype; hematopoietic system phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); endocrine/exocrine gland phenotype; homeostasis/metabolism phenotype; cellular phenotype; growth/size/body region phenotype

Gene ontology

• Biological process: negative regulation of transcription by RNA polymerase II;DNA unwinding involved in DNA replication;DNA replication initiation;nervous system development;positive regulation of cell population proliferation;negative regulation of translation;cell differentiation;dendritic transport of messenger ribonucleoprotein complex
• Cellular component: nuclear chromosome, telomeric region;nucleus;DNA replication factor A complex;dendrite cytoplasm;neuronal cell body;postsynapse;glutamatergic synapse
• Molecular function: translation repressor activity, mRNA regulatory element binding;RNA polymerase II regulatory region sequence-specific DNA binding;DNA-binding transcription factor activity, RNA polymerase II-specific;DNA-binding transcription repressor activity, RNA polymerase II-specific;double-stranded DNA binding;double-stranded telomeric DNA binding;single-stranded DNA binding;RNA binding;protein binding;transcription factor binding;purine-rich negative regulatory element binding;sequence-specific DNA binding;SMAD binding