5-147824622-GCCTCGCGGTGACCTGATGGGATTTCAAAA-G

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_001379610.1(SPINK1):​c.*10_*38delTTTTGAAATCCCATCAGGTCACCGCGAGG variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

SPINK1
NM_001379610.1 3_prime_UTR

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 1.13
Variant links:
Genes affected
SPINK1 (HGNC:11244): (serine peptidase inhibitor Kazal type 1) The protein encoded by this gene is a trypsin inhibitor, which is secreted from pancreatic acinar cells into pancreatic juice. It is thought to function in the prevention of trypsin-catalyzed premature activation of zymogens within the pancreas and the pancreatic duct. Mutations in this gene are associated with hereditary pancreatitis and tropical calcific pancreatitis. [provided by RefSeq, Oct 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 2 ACMG points.

PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
SPINK1NM_001379610.1 linkc.*10_*38delTTTTGAAATCCCATCAGGTCACCGCGAGG 3_prime_UTR_variant Exon 4 of 4 ENST00000296695.10 NP_001366539.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
SPINK1ENST00000296695.10 linkc.*10_*38delTTTTGAAATCCCATCAGGTCACCGCGAGG 3_prime_UTR_variant Exon 4 of 4 1 NM_001379610.1 ENSP00000296695.5 P00995
SPINK1ENST00000505722.1 linkn.165_193delTTTTGAAATCCCATCAGGTCACCGCGAGG non_coding_transcript_exon_variant Exon 2 of 2 2

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not specified Uncertain:1
Aug 18, 2023
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

Variant summary: SPINK1 c.*10_*38del29 is located in the untranslated mRNA region downstream of the termination codon. The variant was absent in 250562 control chromosomes (gnomAD). The available data on variant occurrences in the general population are insufficient to allow any conclusion about variant significance. To our knowledge, no occurrence of c.*10_*38del29 in individuals affected with Chronic Pancreatitis Risk and no experimental evidence demonstrating its impact on protein function have been reported. No submitters have cited clinical-significance assessments for this variant to ClinVar after 2014. Based on the evidence outlined above, the variant was classified as uncertain significance. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr5-147204185; API