5-147824622-GCCTCGCGGTGACCTGATGGGATTTCAAAA-G
Variant summary
Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2
The NM_001379610.1(SPINK1):c.*10_*38delTTTTGAAATCCCATCAGGTCACCGCGAGG variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001379610.1 3_prime_UTR
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 2 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
SPINK1 | NM_001379610.1 | c.*10_*38delTTTTGAAATCCCATCAGGTCACCGCGAGG | 3_prime_UTR_variant | Exon 4 of 4 | ENST00000296695.10 | NP_001366539.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
SPINK1 | ENST00000296695.10 | c.*10_*38delTTTTGAAATCCCATCAGGTCACCGCGAGG | 3_prime_UTR_variant | Exon 4 of 4 | 1 | NM_001379610.1 | ENSP00000296695.5 | |||
SPINK1 | ENST00000505722.1 | n.165_193delTTTTGAAATCCCATCAGGTCACCGCGAGG | non_coding_transcript_exon_variant | Exon 2 of 2 | 2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
not specified Uncertain:1
Variant summary: SPINK1 c.*10_*38del29 is located in the untranslated mRNA region downstream of the termination codon. The variant was absent in 250562 control chromosomes (gnomAD). The available data on variant occurrences in the general population are insufficient to allow any conclusion about variant significance. To our knowledge, no occurrence of c.*10_*38del29 in individuals affected with Chronic Pancreatitis Risk and no experimental evidence demonstrating its impact on protein function have been reported. No submitters have cited clinical-significance assessments for this variant to ClinVar after 2014. Based on the evidence outlined above, the variant was classified as uncertain significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
Publications
No publications associated with this variant yet.