chr5-147824622-GCCTCGCGGTGACCTGATGGGATTTCAAAA-G

Position:

• chr5-147824622-GCCTCGCGGTGACCTGATGGGATTTCAAAA-G

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_001379610.1(SPINK1):​c.*10_*38delTTTTGAAATCCCATCAGGTCACCGCGAGG variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: SPINK1 NM_001379610.1 3_prime_UTR
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.13

Genes affected

SPINK1 (HGNC:11244): (serine peptidase inhibitor Kazal type 1) The protein encoded by this gene is a trypsin inhibitor, which is secreted from pancreatic acinar cells into pancreatic juice. It is thought to function in the prevention of trypsin-catalyzed premature activation of zymogens within the pancreas and the pancreatic duct. Mutations in this gene are associated with hereditary pancreatitis and tropical calcific pancreatitis. [provided by RefSeq, Oct 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
SPINK1	NM_001379610.1	c.*10_*38delTTTTGAAATCCCATCAGGTCACCGCGAGG		3_prime_UTR_variant	4/4	ENST00000296695.10	NP_001366539.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
SPINK1	ENST00000296695	c.*10_*38delTTTTGAAATCCCATCAGGTCACCGCGAGG		3_prime_UTR_variant	4/4	1	NM_001379610.1	ENSP00000296695.5
SPINK1	ENST00000505722.1	n.165_193delTTTTGAAATCCCATCAGGTCACCGCGAGG		non_coding_transcript_exon_variant	2/2	2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Aug 18, 2023

Variant summary: SPINK1 c.*10_*38del29 is located in the untranslated mRNA region downstream of the termination codon. The variant was absent in 250562 control chromosomes (gnomAD). The available data on variant occurrences in the general population are insufficient to allow any conclusion about variant significance. To our knowledge, no occurrence of c.*10_*38del29 in individuals affected with Chronic Pancreatitis Risk and no experimental evidence demonstrating its impact on protein function have been reported. No submitters have cited clinical-significance assessments for this variant to ClinVar after 2014. Based on the evidence outlined above, the variant was classified as uncertain significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr5-147204185;