5-179616089-ATAACTTACTCTAAGTACAGTAACAAACAGGCTTTACCG-A

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1PM2

The NM_001257293.2(HNRNPH1):​c.1299_1300+36delCGGTAAAGCCTGTTTGTTACTGTACTTAGAGTAAGTTA​(p.Tyr433fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

HNRNPH1
NM_001257293.2 frameshift, splice_donor, splice_region, intron

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 0.499
Variant links:
Genes affected
HNRNPH1 (HGNC:5041): (heterogeneous nuclear ribonucleoprotein H1) This gene encodes a member of a subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins that complex with heterogeneous nuclear RNA. These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some may shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNA and is very similar to the family member HNRPF. This gene may be associated with hereditary lymphedema type I. Alternatively spliced transcript variants have been described [provided by RefSeq, Mar 2012]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 10 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
HNRNPH1NM_001257293.2 linkc.1299_1300+36delCGGTAAAGCCTGTTTGTTACTGTACTTAGAGTAAGTTA p.Tyr433fs frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant 12/14 ENST00000393432.9 NP_001244222.1

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
HNRNPH1ENST00000393432.9 linkc.1299_1300+36delCGGTAAAGCCTGTTTGTTACTGTACTTAGAGTAAGTTA p.Tyr433fs frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant 12/141 NM_001257293.2 ENSP00000377082.4 P31943

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not provided Uncertain:1
Uncertain significance, criteria provided, single submitterclinical testingGeneDxSep 10, 2019Not observed in large population cohorts (Lek et al., 2016); Canonical splice site variant in a gene for which loss-of-function is not a known mechanism of disease; Has not been previously published as pathogenic or benign to our knowledge; Variants in candidate genes are classified as variants of uncertain significance in accordance with ACMG guidelines (Richards et al., 2015) -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr5-179043090; API