5-53109714-GGCACAGCGGCACCATCCCGCCTA-G

Position:

• chr5-53109714-GGCACAGCGGCACCATCCCGCCTA-G

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1_Strong PS1_Moderate PM2 PP5_Moderate

The NM_176806.4(MOCS2):​c.-8_15delTAGGCGGGATGGTGCCGCTGTGC​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: MOCS2 NM_176806.4 frameshift, start_lost
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 3.20

Genes affected

MOCS2 (HGNC:7193): (molybdenum cofactor synthesis 2) Eukaryotic molybdoenzymes use a unique molybdenum cofactor (MoCo) consisting of a pterin, termed molybdopterin, and the catalytically active metal molybdenum. MoCo is synthesized from precursor Z by the heterodimeric enzyme molybdopterin synthase. The large and small subunits of molybdopterin synthase are both encoded from this gene by overlapping open reading frames. The proteins were initially thought to be encoded from a bicistronic transcript. They are now thought to be encoded from monocistronic transcripts. Alternatively spliced transcripts have been found for this locus that encode the large and small subunits. [provided by RefSeq, Jul 2008]

MOCS2 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 10 pathogenic variants in the truncated region.
• PS1: Another start lost variant in NM_176806.4 (MOCS2) was described as [Pathogenic] in Lovd
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 5-53109714-GGCACAGCGGCACCATCCCGCCTA-G is Pathogenic according to our data. Variant chr5-53109714-GGCACAGCGGCACCATCCCGCCTA-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 6116.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr5-53109714-GGCACAGCGGCACCATCCCGCCTA-G is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MOCS2	NM_176806.4	c.-8_15delTAGGCGGGATGGTGCCGCTGTGC	p.Met1fs	frameshift_variant, start_lost	1/7	ENST00000450852.8	NP_789776.1
MOCS2	NM_004531.5	c.-656_-634delTAGGCGGGATGGTGCCGCTGTGC		5_prime_UTR_variant	1/7	ENST00000396954.8	NP_004522.1
MOCS2	NM_176806.4	c.-8_15delTAGGCGGGATGGTGCCGCTGTGC		5_prime_UTR_variant	1/7	ENST00000450852.8	NP_789776.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MOCS2	ENST00000450852.8	c.-8_15delTAGGCGGGATGGTGCCGCTGTGC	p.Met1fs	frameshift_variant, start_lost	1/7	1	NM_176806.4	ENSP00000411022.3
MOCS2	ENST00000396954.8	c.-656_-634delTAGGCGGGATGGTGCCGCTGTGC		5_prime_UTR_variant	1/7	1	NM_004531.5	ENSP00000380157.3
MOCS2	ENST00000450852.8	c.-8_15delTAGGCGGGATGGTGCCGCTGTGC		5_prime_UTR_variant	1/7	1	NM_176806.4	ENSP00000411022.3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, single submitter

Submissions by phenotype

Sulfite oxidase deficiency due to molybdenum cofactor deficiency type B Pathogenic:2

Likely pathogenic, criteria provided, single submitter	clinical testing	Greenwood Genetic Center Diagnostic Laboratories, Greenwood Genetic Center	Jul 05, 2023	PVS1, PM2 -
Pathogenic, no assertion criteria provided	literature only	OMIM	Nov 01, 2006	- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs397518417; hg19: chr5-52405544;