rs397518417

Variant names:

• chr5-53109714-GGCACAGCGGCACCATCCCGCCTA-G
• rs397518417
• NM_176806.4:c.-8_15delTAGGCGGGATGGTGCCGCTGTGC

Variant summary

Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1 PS1_Moderate PP5_Moderate

The NM_176806.4(MOCS2):​c.-8_15delTAGGCGGGATGGTGCCGCTGTGC​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: MOCS2 NM_176806.4 frameshift, start_lost
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 3.20
• Publications: 2 publications found

Genes affected

MOCS2 (HGNC:7193): (molybdenum cofactor synthesis 2) Eukaryotic molybdoenzymes use a unique molybdenum cofactor (MoCo) consisting of a pterin, termed molybdopterin, and the catalytically active metal molybdenum. MoCo is synthesized from precursor Z by the heterodimeric enzyme molybdopterin synthase. The large and small subunits of molybdopterin synthase are both encoded from this gene by overlapping open reading frames. The proteins were initially thought to be encoded from a bicistronic transcript. They are now thought to be encoded from monocistronic transcripts. Alternatively spliced transcripts have been found for this locus that encode the large and small subunits. [provided by RefSeq, Jul 2008]

MOCS2-DT (HGNC:27417): (MOCS2 divergent transcript)

ACMG classification

Our verdict: Pathogenic. The variant received 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 22 pathogenic variants in the truncated region.
• PS1: Another start lost variant in NM_176806.4 (MOCS2) was described as [Pathogenic] in ClinVar
• PP5: Variant 5-53109714-GGCACAGCGGCACCATCCCGCCTA-G is Pathogenic according to our data. Variant chr5-53109714-GGCACAGCGGCACCATCCCGCCTA-G is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 6116.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_176806.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MOCS2	NM_176806.4	MANE Plus Clinical	c.-8_15delTAGGCGGGATGGTGCCGCTGTGC	p.Met1fs	frameshift start_lost	Exon 1 of 7	NP_789776.1	O96033
	MOCS2	NM_004531.5	MANE Select	c.-656_-634delTAGGCGGGATGGTGCCGCTGTGC		5_prime_UTR	Exon 1 of 7	NP_004522.1	O96007
	MOCS2	NM_176806.4	MANE Plus Clinical	c.-8_15delTAGGCGGGATGGTGCCGCTGTGC		5_prime_UTR	Exon 1 of 7	NP_789776.1	O96033

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MOCS2	ENST00000450852.8	TSL:1 MANE Plus Clinical	c.-8_15delTAGGCGGGATGGTGCCGCTGTGC	p.Met1fs	frameshift start_lost	Exon 1 of 7	ENSP00000411022.3	O96033
	MOCS2	ENST00000396954.8	TSL:1 MANE Select	c.-656_-634delTAGGCGGGATGGTGCCGCTGTGC		5_prime_UTR	Exon 1 of 7	ENSP00000380157.3	O96007
	MOCS2	ENST00000450852.8	TSL:1 MANE Plus Clinical	c.-8_15delTAGGCGGGATGGTGCCGCTGTGC		5_prime_UTR	Exon 1 of 7	ENSP00000411022.3	O96033

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

Alfa AF: 0.00 Hom.: 0

ClinVar

ClinVar submissions

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
2	-	-	Sulfite oxidase deficiency due to molybdenum cofactor deficiency type B (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.2
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs397518417;

hg19: chr5-52405544;