5-668207-CGACAAGCACACAGAGAGGGGGCCGTGTGGGCGCCGTCAGGGAAGTGCG-C

Position:

• chr5-668207-CGACAAGCACACAGAGAGGGGGCCGTGTGGGCGCCGTCAGGGAAGTGCG-C

Variant summary

Our verdict is Likely benign. Variant got -6 ACMG points: 0P and 6B. BP6_Moderate BS2

The NM_007030.3(TPPP):​c.312-2132_312-2085delCGCACTTCCCTGACGGCGCCCACACGGCCCCCTCTCTGTGTGCTTGTC variant causes a intron change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Likely benign (★).

• Frequency: Genomes: 𝑓 0.0024 (16 hom., cov: 15)
• Consequence: TPPP NM_007030.3 intron
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.275

Genes affected

TPPP (HGNC:24164): (tubulin polymerization promoting protein) Enables several functions, including GTPase activity; magnesium ion binding activity; and protein homodimerization activity. Involved in several processes, including microtubule cytoskeleton organization; negative regulation of tubulin deacetylation; and positive regulation of protein polymerization. Located in several cellular components, including mitochondrion; mitotic spindle; and perinuclear region of cytoplasm. Colocalizes with microtubule and microtubule bundle. [provided by Alliance of Genome Resources, Apr 2022]

CEP72 (HGNC:25547): (centrosomal protein 72) The product of this gene is a member of the leucine-rich-repeat (LRR) superfamily of proteins. The protein is localized to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_benign. Variant got -6 ACMG points.

• BP6: Variant 5-668207-CGACAAGCACACAGAGAGGGGGCCGTGTGGGCGCCGTCAGGGAAGTGCG-C is Benign according to our data. Variant chr5-668207-CGACAAGCACACAGAGAGGGGGCCGTGTGGGCGCCGTCAGGGAAGTGCG-C is described in ClinVar as [Likely_benign]. Clinvar id is 2655252.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High Homozygotes in GnomAd4 at 16 AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
TPPP	NM_007030.3	c.312-2132_312-2085delCGCACTTCCCTGACGGCGCCCACACGGCCCCCTCTCTGTGTGCTTGTC		intron_variant		ENST00000360578.7	NP_008961.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
TPPP	ENST00000360578.7	c.312-2132_312-2085delCGCACTTCCCTGACGGCGCCCACACGGCCCCCTCTCTGTGTGCTTGTC		intron_variant		1	NM_007030.3	ENSP00000353785.5

Frequencies

GnomAD3 genomes AF: 0.00237 AC: 221 AN: 93216 Hom.: 17 Cov.: 15

Gnomad AFR AF: 0.00855

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000970

Gnomad ASJ AF: 0.000436

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000663

Gnomad OTH AF: 0.00155

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.00236 AC: 220 AN: 93246 Hom.: 16 Cov.: 15 AF XY: 0.00229 AC XY: 103 AN XY: 45074

Gnomad4 AFR AF: 0.00849

Gnomad4 AMR AF: 0.000970

Gnomad4 ASJ AF: 0.000436

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000664

Gnomad4 OTH AF: 0.00153

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Likely benign, criteria provided, single submitter

clinical testing

CeGaT Center for Human Genetics Tuebingen

Dec 01, 2022

TPPP: BS2 -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1561081956; hg19: chr5-668322;