6-137198270-CATTTCTGGAGTGATCACTCTCAGAACA-C

Position:

• chr6-137198270-CATTTCTGGAGTGATCACTCTCAGAACA-C

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM4

The NM_000416.3(IFNGR1):​c.1204_1230delTGTTCTGAGAGTGATCACTCCAGAAAT​(p.Cys402_Asn410del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000821 in 1,461,836 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000082 (0 hom.)
• Consequence: IFNGR1 NM_000416.3 conservative_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.335

Genes affected

IFNGR1 (HGNC:5439): (interferon gamma receptor 1) This gene (IFNGR1) encodes the ligand-binding chain (alpha) of the gamma interferon receptor. Human interferon-gamma receptor is a heterodimer of IFNGR1 and IFNGR2. A genetic variation in IFNGR1 is associated with susceptibility to Helicobacter pylori infection. In addition, defects in IFNGR1 are a cause of mendelian susceptibility to mycobacterial disease, also known as familial disseminated atypical mycobacterial infection. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000416.3.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
IFNGR1	NM_000416.3	c.1204_1230delTGTTCTGAGAGTGATCACTCCAGAAAT	p.Cys402_Asn410del	conservative_inframe_deletion	7/7	ENST00000367739.9	NP_000407.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
IFNGR1	ENST00000367739.9	c.1204_1230delTGTTCTGAGAGTGATCACTCCAGAAAT	p.Cys402_Asn410del	conservative_inframe_deletion	7/7	1	NM_000416.3	ENSP00000356713.5

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000821 AC: 12 AN: 1461836 Hom.: 0 AF XY: 0.0000110 AC XY: 8 AN XY: 727218

Gnomad4 AFR exome AF: 0.0000299

Gnomad4 AMR exome AF: 0.0000224

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000252

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.0000374

Gnomad4 NFE exome AF: 0.00000629

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

Alfa AF: 0.0000507 Hom.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs137854905; hg19: chr6-137519407;