6-33172579-GGCCCCGGGGGGCCTGGGTGACCTCTCT-G

Position:

• chr6-33172579-GGCCCCGGGGGGCCTGGGTGACCTCTCT-G

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM2 PM4 PP3 PP5

The NM_080680.3(COL11A2):​c.2822_2848delAGAGAGGTCACCCAGGCCCCCCGGGGC​(p.Glu941_Pro950delinsAla) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 31)
• Consequence: COL11A2 NM_080680.3 disruptive_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.93

Genes affected

COL11A2 (HGNC:2187): (collagen type XI alpha 2 chain) This gene encodes one of the two alpha chains of type XI collagen, a minor fibrillar collagen. It is located on chromosome 6 very close to but separate from the gene for retinoid X receptor beta. Type XI collagen is a heterotrimer but the third alpha chain is a post-translationally modified alpha 1 type II chain. Proteolytic processing of this type XI chain produces PARP, a proline/arginine-rich protein that is an amino terminal domain. Mutations in this gene are associated with type III Stickler syndrome, otospondylomegaepiphyseal dysplasia (OSMED syndrome), Weissenbacher-Zweymuller syndrome, autosomal dominant non-syndromic sensorineural type 13 deafness (DFNA13), and autosomal recessive non-syndromic sensorineural type 53 deafness (DFNB53). Alternative splicing results in multiple transcript variants. A related pseudogene is located nearby on chromosome 6. [provided by RefSeq, Jul 2009]

COL11A2 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_080680.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 6-33172579-GGCCCCGGGGGGCCTGGGTGACCTCTCT-G is Pathogenic according to our data. Variant chr6-33172579-GGCCCCGGGGGGCCTGGGTGACCTCTCT-G is described in ClinVar as [Pathogenic]. Clinvar id is 17122.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
COL11A2	NM_080680.3	c.2822_2848delAGAGAGGTCACCCAGGCCCCCCGGGGC	p.Glu941_Pro950delinsAla	disruptive_inframe_deletion	39/66	ENST00000341947.7	NP_542411.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
COL11A2	ENST00000341947.7	c.2822_2848delAGAGAGGTCACCCAGGCCCCCCGGGGC	p.Glu941_Pro950delinsAla	disruptive_inframe_deletion	39/66	5	NM_080680.3	ENSP00000339915.2
COL11A2	ENST00000374708.8	c.2564_2590delAGAGAGGTCACCCAGGCCCCCCGGGGC	p.Glu855_Pro864delinsAla	disruptive_inframe_deletion	37/64	5		ENSP00000363840.4
COL11A2	ENST00000477772.1	n.272+4403_272+4429delAGAGAGGTCACCCAGGCCCCCCGGGGC		intron_variant		2

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Otospondylomegaepiphyseal dysplasia, autosomal dominant Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Feb 01, 1998

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs864309477; hg19: chr6-33140356;