6-33172579-GGCCCCGGGGGGCCTGGGTGACCTCTCT-G

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4PP3PP5

The NM_080680.3(COL11A2):​c.2822_2848delAGAGAGGTCACCCAGGCCCCCCGGGGC​(p.Glu941_Pro950delinsAla) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

Frequency

Genomes: not found (cov: 31)

Consequence

COL11A2
NM_080680.3 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Pathogenic no assertion criteria provided P:1

Conservation

PhyloP100: 9.93

Publications

0 publications found
Variant links:
Genes affected
COL11A2 (HGNC:2187): (collagen type XI alpha 2 chain) This gene encodes one of the two alpha chains of type XI collagen, a minor fibrillar collagen. It is located on chromosome 6 very close to but separate from the gene for retinoid X receptor beta. Type XI collagen is a heterotrimer but the third alpha chain is a post-translationally modified alpha 1 type II chain. Proteolytic processing of this type XI chain produces PARP, a proline/arginine-rich protein that is an amino terminal domain. Mutations in this gene are associated with type III Stickler syndrome, otospondylomegaepiphyseal dysplasia (OSMED syndrome), Weissenbacher-Zweymuller syndrome, autosomal dominant non-syndromic sensorineural type 13 deafness (DFNA13), and autosomal recessive non-syndromic sensorineural type 53 deafness (DFNB53). Alternative splicing results in multiple transcript variants. A related pseudogene is located nearby on chromosome 6. [provided by RefSeq, Jul 2009]
COL11A2 Gene-Disease associations (from GenCC):
  • autosomal dominant nonsyndromic hearing loss 13
    Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, LIMITED Submitted by: Ambry Genetics, PanelApp Australia, Labcorp Genetics (formerly Invitae), G2P
  • nonsyndromic genetic hearing loss
    Inheritance: AD, AR Classification: DEFINITIVE, MODERATE Submitted by: ClinGen
  • otospondylomegaepiphyseal dysplasia, autosomal dominant
    Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: PanelApp Australia, Ambry Genetics, Orphanet, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), G2P
  • autosomal recessive nonsyndromic hearing loss 53
    Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: G2P, PanelApp Australia, Ambry Genetics, Labcorp Genetics (formerly Invitae)
  • otospondylomegaepiphyseal dysplasia
    Inheritance: AR, AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
  • otospondylomegaepiphyseal dysplasia, autosomal recessive
    Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: PanelApp Australia, Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)
  • autosomal dominant nonsyndromic hearing loss
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • fibrochondrogenesis
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • hearing loss, autosomal recessive
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

PM4
Nonframeshift variant in NON repetitive region in NM_080680.3.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
PP5
Variant 6-33172579-GGCCCCGGGGGGCCTGGGTGACCTCTCT-G is Pathogenic according to our data. Variant chr6-33172579-GGCCCCGGGGGGCCTGGGTGACCTCTCT-G is described in ClinVar as Pathogenic. ClinVar VariationId is 17122.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
COL11A2NM_080680.3 linkc.2822_2848delAGAGAGGTCACCCAGGCCCCCCGGGGC p.Glu941_Pro950delinsAla disruptive_inframe_deletion Exon 39 of 66 ENST00000341947.7 NP_542411.2 P13942A0A0C4DFS1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
COL11A2ENST00000341947.7 linkc.2822_2848delAGAGAGGTCACCCAGGCCCCCCGGGGC p.Glu941_Pro950delinsAla disruptive_inframe_deletion Exon 39 of 66 5 NM_080680.3 ENSP00000339915.2 A0A0C4DFS1
COL11A2ENST00000374708.8 linkc.2564_2590delAGAGAGGTCACCCAGGCCCCCCGGGGC p.Glu855_Pro864delinsAla disruptive_inframe_deletion Exon 37 of 64 5 ENSP00000363840.4 Q4VXY6
COL11A2ENST00000477772.1 linkn.272+4403_272+4429delAGAGAGGTCACCCAGGCCCCCCGGGGC intron_variant Intron 5 of 8 2

Frequencies

GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
31

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: no assertion criteria provided
LINK: link

Submissions by phenotype

Otospondylomegaepiphyseal dysplasia, autosomal dominant Pathogenic:1
Feb 01, 1998
OMIM
Significance:Pathogenic
Review Status:no assertion criteria provided
Collection Method:literature only

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.9
Mutation Taster
=1/199
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs864309477; hg19: chr6-33140356; API