rs864309477

Variant names:

• chr6-33172579-GGCCCCGGGGGGCCTGGGTGACCTCTCT-G
• rs864309477
• NM_080680.3:c.2822_2848delAGAGAGGTCACCCAGGCCCCCCGGGGC

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4 PP3 PP5

The NM_080680.3(COL11A2):​c.2822_2848delAGAGAGGTCACCCAGGCCCCCCGGGGC​(p.Glu941_Pro950delinsAla) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 31)
• Consequence: COL11A2 NM_080680.3 disruptive_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.93
• Publications: 0 publications found

Genes affected

COL11A2 (HGNC:2187): (collagen type XI alpha 2 chain) This gene encodes one of the two alpha chains of type XI collagen, a minor fibrillar collagen. It is located on chromosome 6 very close to but separate from the gene for retinoid X receptor beta. Type XI collagen is a heterotrimer but the third alpha chain is a post-translationally modified alpha 1 type II chain. Proteolytic processing of this type XI chain produces PARP, a proline/arginine-rich protein that is an amino terminal domain. Mutations in this gene are associated with type III Stickler syndrome, otospondylomegaepiphyseal dysplasia (OSMED syndrome), Weissenbacher-Zweymuller syndrome, autosomal dominant non-syndromic sensorineural type 13 deafness (DFNA13), and autosomal recessive non-syndromic sensorineural type 53 deafness (DFNB53). Alternative splicing results in multiple transcript variants. A related pseudogene is located nearby on chromosome 6. [provided by RefSeq, Jul 2009]

COL11A2 Gene-Disease associations (from GenCC):

• autosomal dominant nonsyndromic hearing loss 13

  Inheritance: AD Classification: DEFINITIVE, STRONG, LIMITED Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)
• otospondylomegaepiphyseal dysplasia, autosomal dominant

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, G2P, Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
• autosomal recessive nonsyndromic hearing loss 53

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• nonsyndromic genetic hearing loss

  Inheritance: AR, AD Classification: DEFINITIVE, MODERATE Submitted by: ClinGen
• otospondylomegaepiphyseal dysplasia

  Inheritance: AR, AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• otospondylomegaepiphyseal dysplasia, autosomal recessive

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
• autosomal dominant nonsyndromic hearing loss

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• fibrochondrogenesis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• hearing loss, autosomal recessive

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_080680.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 6-33172579-GGCCCCGGGGGGCCTGGGTGACCTCTCT-G is Pathogenic according to our data. Variant chr6-33172579-GGCCCCGGGGGGCCTGGGTGACCTCTCT-G is described in ClinVar as Pathogenic. ClinVar VariationId is 17122.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_080680.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COL11A2	NM_080680.3	MANE Select	c.2822_2848delAGAGAGGTCACCCAGGCCCCCCGGGGC	p.Glu941_Pro950delinsAla	disruptive_inframe_deletion	Exon 39 of 66	NP_542411.2	A0A0C4DFS1
	COL11A2	NM_001424108.1		c.2642_2668delAGAGAGGTCACCCAGGCCCCCCGGGGC	p.Glu881_Pro890delinsAla	disruptive_inframe_deletion	Exon 38 of 65	NP_001411037.1
	COL11A2	NM_080681.3		c.2564_2590delAGAGAGGTCACCCAGGCCCCCCGGGGC	p.Glu855_Pro864delinsAla	disruptive_inframe_deletion	Exon 37 of 64	NP_542412.2	Q4VXY6

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COL11A2	ENST00000341947.7	TSL:5 MANE Select	c.2822_2848delAGAGAGGTCACCCAGGCCCCCCGGGGC	p.Glu941_Pro950delinsAla	disruptive_inframe_deletion	Exon 39 of 66	ENSP00000339915.2	A0A0C4DFS1
	COL11A2	ENST00000930122.1		c.2642_2668delAGAGAGGTCACCCAGGCCCCCCGGGGC	p.Glu881_Pro890delinsAla	disruptive_inframe_deletion	Exon 38 of 65	ENSP00000600181.1
	COL11A2	ENST00000374708.8	TSL:5	c.2564_2590delAGAGAGGTCACCCAGGCCCCCCGGGGC	p.Glu855_Pro864delinsAla	disruptive_inframe_deletion	Exon 37 of 64	ENSP00000363840.4	Q4VXY6

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Otospondylomegaepiphyseal dysplasia, autosomal dominant (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.9
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs864309477; hg19: chr6-33140356;