6-81752010-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG

Variant names:

• chr6-81752010-A-ACCGCCGAAGTCGCCG
• rs754008809
• NM_017633.3:c.117_131dupCGGCGACTTCGGCGG

Variant summary

Our verdict is Benign. The variant received -14 ACMG points: 2P and 16B. PM4 BP6_Very_Strong BA1

The NM_017633.3(TENT5A):​c.117_131dupCGGCGACTTCGGCGG​(p.Gly44_Gly45insGlyAspPheGlyGly) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.291 in 1,339,720 control chromosomes in the GnomAD database, including 108,731 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. G44G) has been classified as Benign.

• Frequency:
  • Genomes: 𝑓 0.45 (15291 hom., cov: 0)
  • Exomes 𝑓: 0.27 (93440 hom.)
• Consequence: TENT5A NM_017633.3 disruptive_inframe_insertion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:7
• Conservation: PhyloP100: 0.0420
• Publications: 6 publications found

Genes affected

TENT5A (HGNC:18345): (terminal nucleotidyltransferase 5A) Enables RNA binding activity. Predicted to be involved in mRNA stabilization. Predicted to act upstream of or within response to bacterium. Implicated in lung non-small cell carcinoma; osteoarthritis; and osteogenesis imperfecta type 18. [provided by Alliance of Genome Resources, Apr 2022]

TENT5A Gene-Disease associations (from GenCC):

• osteogenesis imperfecta, type 18

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• osteogenesis imperfecta

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -14 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_017633.3.
• BP6: Variant 6-81752010-A-ACCGCCGAAGTCGCCG is Benign according to our data. Variant chr6-81752010-A-ACCGCCGAAGTCGCCG is described in ClinVar as Benign/Likely_benign. ClinVar VariationId is 769684.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BA1: GnomAd4 highest subpopulation (EAS) allele frequency at 95% confidence interval = 0.524 is higher than 0.05.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_017633.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TENT5A	NM_017633.3	MANE Select	c.117_131dupCGGCGACTTCGGCGG	p.Gly44_Gly45insGlyAspPheGlyGly	disruptive_inframe_insertion	Exon 2 of 3	NP_060103.2	Q96IP4-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TENT5A	ENST00000320172.11	TSL:1 MANE Select	c.117_131dupCGGCGACTTCGGCGG	p.Gly44_Gly45insGlyAspPheGlyGly	disruptive_inframe_insertion	Exon 2 of 3	ENSP00000318298.6	Q96IP4-1
	TENT5A	ENST00000369756.3	TSL:1	c.360_374dupCGGCGACTTCGGCGG	p.Gly125_Gly126insGlyAspPheGlyGly	disruptive_inframe_insertion	Exon 2 of 3	ENSP00000358771.3	Q5TF85
	TENT5A	ENST00000369754.7	TSL:1	c.174_188dupCGGCGACTTCGGCGG	p.Gly63_Gly64insGlyAspPheGlyGly	disruptive_inframe_insertion	Exon 2 of 3	ENSP00000358769.3	Q96IP4-2

Frequencies

GnomAD3 genomes AF: 0.448 AC: 62497 AN: 139368 Hom.: 15272 Cov.: 0

Gnomad AFR AF: 0.517

Gnomad AMI AF: 0.508

Gnomad AMR AF: 0.428

Gnomad ASJ AF: 0.401

Gnomad EAS AF: 0.542

Gnomad SAS AF: 0.422

Gnomad FIN AF: 0.382

Gnomad MID AF: 0.424

Gnomad NFE AF: 0.421

Gnomad OTH AF: 0.436

GnomAD4 exome AF: 0.273 AC: 327410 AN: 1200274 Hom.: 93440 Cov.: 34 AF XY: 0.278 AC XY: 167481 AN XY: 602742

African (AFR) AF: 0.378 AC: 9581 AN: 25374

American (AMR) AF: 0.228 AC: 8483 AN: 37150

Ashkenazi Jewish (ASJ) AF: 0.300 AC: 6871 AN: 22924

East Asian (EAS) AF: 0.495 AC: 18735 AN: 37818

South Asian (SAS) AF: 0.317 AC: 23586 AN: 74420

European-Finnish (FIN) AF: 0.292 AC: 12523 AN: 42908

Middle Eastern (MID) AF: 0.297 AC: 1215 AN: 4096

European-Non Finnish (NFE) AF: 0.255 AC: 230355 AN: 904258

Other (OTH) AF: 0.313 AC: 16061 AN: 51326

GnomAD4 genome AF: 0.449 AC: 62545 AN: 139446 Hom.: 15291 Cov.: 0 AF XY: 0.447 AC XY: 30190 AN XY: 67570

African (AFR) AF: 0.517 AC: 18875 AN: 36510

American (AMR) AF: 0.429 AC: 6107 AN: 14250

Ashkenazi Jewish (ASJ) AF: 0.401 AC: 1337 AN: 3338

East Asian (EAS) AF: 0.542 AC: 2463 AN: 4544

South Asian (SAS) AF: 0.424 AC: 1768 AN: 4170

European-Finnish (FIN) AF: 0.382 AC: 3629 AN: 9492

Middle Eastern (MID) AF: 0.418 AC: 112 AN: 268

European-Non Finnish (NFE) AF: 0.421 AC: 26956 AN: 64060

Other (OTH) AF: 0.440 AC: 851 AN: 1934

Alfa AF: 0.261 Hom.: 1118

ClinVar

ClinVar submissions

Significance: Benign/Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	3	not specified (3)
-	-	2	not provided (2)
-	-	2	Osteogenesis imperfecta, type 18 (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.042
Mutation Taster		=83/17	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs754008809; hg19: chr6-82461727; COSMIC: COSV60787885; COSMIC: COSV60787885;