6-81752010-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG

Position:

• chr6-81752010-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG

Variant summary

Our verdict is Benign. Variant got -14 ACMG points: 2P and 16B. PM4 BP6_Very_Strong BA1

The NM_017633.3(TENT5A):​c.131_132insCGGCGACTTCGGCGG​(p.Asp41_Gly45dup) variant causes a inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.291 in 1,339,720 control chromosomes in the GnomAD database, including 108,731 homozygotes. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. G44G) has been classified as Benign.

• Frequency:
  • Genomes: 𝑓 0.45 (15291 hom., cov: 0)
  • Exomes 𝑓: 0.27 (93440 hom.)
• Consequence: TENT5A NM_017633.3 inframe_insertion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:6
• Conservation: PhyloP100: 0.0420

Genes affected

TENT5A (HGNC:18345): (terminal nucleotidyltransferase 5A) Enables RNA binding activity. Predicted to be involved in mRNA stabilization. Predicted to act upstream of or within response to bacterium. Implicated in lung non-small cell carcinoma; osteoarthritis; and osteogenesis imperfecta type 18. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Benign. Variant got -14 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_017633.3.
• BP6: Variant 6-81752010-A-ACCGCCGAAGTCGCCG is Benign according to our data. Variant chr6-81752010-A-ACCGCCGAAGTCGCCG is described in ClinVar as [Likely_benign]. Clinvar id is 769684.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BA1: GnomAd4 highest subpopulation (EAS) allele frequency at 95% confidence interval = 0.524 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
TENT5A	NM_017633.3	c.131_132insCGGCGACTTCGGCGG	p.Asp41_Gly45dup	inframe_insertion	2/3	ENST00000320172.11

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
TENT5A	ENST00000320172.11	c.131_132insCGGCGACTTCGGCGG	p.Asp41_Gly45dup	inframe_insertion	2/3	1	NM_017633.3	A2
TENT5A	ENST00000369754.7	c.188_189insCGGCGACTTCGGCGG	p.Asp60_Gly64dup	inframe_insertion	2/3	1		P4
TENT5A	ENST00000369756.3	c.374_375insCGGCGACTTCGGCGG	p.Asp122_Gly126dup	inframe_insertion	2/3	1

Frequencies

GnomAD3 genomes AF: 0.448 AC: 62497 AN: 139368 Hom.: 15272 Cov.: 0

Gnomad AFR AF: 0.517

Gnomad AMI AF: 0.508

Gnomad AMR AF: 0.428

Gnomad ASJ AF: 0.401

Gnomad EAS AF: 0.542

Gnomad SAS AF: 0.422

Gnomad FIN AF: 0.382

Gnomad MID AF: 0.424

Gnomad NFE AF: 0.421

Gnomad OTH AF: 0.436

GnomAD4 exome AF: 0.273 AC: 327410 AN: 1200274 Hom.: 93440 Cov.: 34 AF XY: 0.278 AC XY: 167481 AN XY: 602742

Gnomad4 AFR exome AF: 0.378

Gnomad4 AMR exome AF: 0.228

Gnomad4 ASJ exome AF: 0.300

Gnomad4 EAS exome AF: 0.495

Gnomad4 SAS exome AF: 0.317

Gnomad4 FIN exome AF: 0.292

Gnomad4 NFE exome AF: 0.255

Gnomad4 OTH exome AF: 0.313

GnomAD4 genome AF: 0.449 AC: 62545 AN: 139446 Hom.: 15291 Cov.: 0 AF XY: 0.447 AC XY: 30190 AN XY: 67570

Gnomad4 AFR AF: 0.517

Gnomad4 AMR AF: 0.429

Gnomad4 ASJ AF: 0.401

Gnomad4 EAS AF: 0.542

Gnomad4 SAS AF: 0.424

Gnomad4 FIN AF: 0.382

Gnomad4 NFE AF: 0.421

Gnomad4 OTH AF: 0.440

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:6

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:2

Benign, no assertion criteria provided	clinical testing	Clinical Genetics DNA and cytogenetics Diagnostics Lab, Erasmus MC, Erasmus Medical Center	-	- -
Benign, no assertion criteria provided	clinical testing	Genome Diagnostics Laboratory, Amsterdam University Medical Center	-	- -

Osteogenesis imperfecta, type 18 Benign:2

Benign, criteria provided, single submitter	clinical testing	Al Jalila Children’s Genomics Center, Al Jalila Childrens Speciality Hospital	Jul 19, 2020	- -
Benign, criteria provided, single submitter	clinical testing	Molecular Genetics, Royal Melbourne Hospital	May 04, 2023	African/African American population allele frequency is 50.47% (rs373591596, 3735/7202 alleles, 1066 homozygotes in gnomAD v2.1). Based on the classification scheme RMH Modified ACMG/AMP Guidelines v1.4.0, this variant is classified as BENIGN. Following criteria are met: BA1 -

not provided Benign:2

Benign, criteria provided, single submitter	clinical testing	GeneDx	Sep 15, 2020	- -
Likely benign, criteria provided, single submitter	clinical testing	Invitae	Jan 31, 2024	- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs754008809; hg19: chr6-82461727;