7-116699071-ATAAACCTCTCATAATGAAGGCCCCCGCTG-A

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The ENST00000456159.1(MET):c.46_74del(p.Lys16AlafsTer21) variant causes a frameshift, splice region change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: MET ENST00000456159.1 frameshift, splice_region
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 2.02

Genes affected

MET (HGNC:7029): (MET proto-oncogene, receptor tyrosine kinase) This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
MET	NM_000245.4	c.-12_17del		start_lost, splice_region_variant, 5_prime_UTR_variant	2/21	ENST00000397752.8

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
MET	ENST00000397752.8	c.-12_17del		start_lost, splice_region_variant, 5_prime_UTR_variant	2/21	1	NM_000245.4	P3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Renal cell carcinoma Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Invitae

May 22, 2018

This variant, c.-12_17del, results in the deletion that affects the initiator methionine of the MET mRNA. The next in-frame methionine is located at codon 35. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with MET-related disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. The current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in MET cause disease. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Hereditary cancer-predisposing syndrome Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Ambry Genetics

Jan 06, 2021

The c.-12_17del29 (p.M1?) alteration is located in coding exon 1 of the MET gene and consists of a AAACCTCTCATAATGAAGGCCCCCGCTGT to ----------------------------- substitution at nucleotide position 1. This changes the amino acid from a methionine to a (?) at the initiation codon. Sequence variations that modify the initiation codon (ATG) are expected to cause a shift in the mRNA reading frame and are typically deleterious in nature (Richards, 2015). Based on insufficient or conflicting evidence, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1562882716; hg19: chr7-116339125;