7-116699071-ATAAACCTCTCATAATGAAGGCCCCCGCTG-A
Variant summary
Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2
The ENST00000456159.1(MET):c.46_74del(p.Lys16AlafsTer21) variant causes a frameshift, splice region change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Genomes: not found (cov: 32)
Consequence
MET
ENST00000456159.1 frameshift, splice_region
ENST00000456159.1 frameshift, splice_region
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 2.02
Genes affected
MET (HGNC:7029): (MET proto-oncogene, receptor tyrosine kinase) This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Uncertain_significance. Variant got 2 ACMG points.
PM2
?
Very rare variant in population databases, with high coverage;
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | UniProt |
---|---|---|---|---|---|---|---|
MET | NM_000245.4 | c.-12_17del | start_lost, splice_region_variant, 5_prime_UTR_variant | 2/21 | ENST00000397752.8 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|
MET | ENST00000397752.8 | c.-12_17del | start_lost, splice_region_variant, 5_prime_UTR_variant | 2/21 | 1 | NM_000245.4 | P3 |
Frequencies
GnomAD3 genomes ? Cov.: 32
GnomAD3 genomes
?
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome ? Cov.: 32
GnomAD4 genome
?
Cov.:
32
ClinVar
Significance: Uncertain significance
Submissions summary: Uncertain:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link
Submissions by phenotype
Renal cell carcinoma Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Invitae | May 22, 2018 | This variant, c.-12_17del, results in the deletion that affects the initiator methionine of the MET mRNA. The next in-frame methionine is located at codon 35. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with MET-related disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. The current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in MET cause disease. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. - |
Hereditary cancer-predisposing syndrome Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Ambry Genetics | Jan 06, 2021 | The c.-12_17del29 (p.M1?) alteration is located in coding exon 1 of the MET gene and consists of a AAACCTCTCATAATGAAGGCCCCCGCTGT to ----------------------------- substitution at nucleotide position 1. This changes the amino acid from a methionine to a (?) at the initiation codon. Sequence variations that modify the initiation codon (ATG) are expected to cause a shift in the mRNA reading frame and are typically deleterious in nature (Richards, 2015). Based on insufficient or conflicting evidence, the clinical significance of this alteration remains unclear. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at