7-116699071-ATAAACCTCTCATAATGAAGGCCCCCGCTG-A

Variant names:

• chr7-116699071-ATAAACCTCTCATAATGAAGGCCCCCGCTG-A
• rs1562882716
• NM_000245.4:c.-12_17delAAACCTCTCATAATGAAGGCCCCCGCTGT

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_000245.4(MET):​c.-12_17delAAACCTCTCATAATGAAGGCCCCCGCTGT​(p.Met1fs) variant causes a frameshift, start lost, splice region change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: MET NM_000245.4 frameshift, start_lost, splice_region
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 2.02

Genes affected

MET (HGNC:7029): (MET proto-oncogene, receptor tyrosine kinase) This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 27 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MET	NM_000245.4	c.-12_17delAAACCTCTCATAATGAAGGCCCCCGCTGT	p.Met1fs	frameshift_variant, start_lost, splice_region_variant	Exon 2 of 21	ENST00000397752.8	NP_000236.2
MET	NM_000245.4	c.-12_17delAAACCTCTCATAATGAAGGCCCCCGCTGT		5_prime_UTR_variant	Exon 2 of 21	ENST00000397752.8	NP_000236.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MET	ENST00000397752.8	c.-12_17delAAACCTCTCATAATGAAGGCCCCCGCTGT	p.Met1fs	frameshift_variant, start_lost, splice_region_variant	Exon 2 of 21	1	NM_000245.4	ENSP00000380860.3
MET	ENST00000397752	c.-12_17delAAACCTCTCATAATGAAGGCCCCCGCTGT		5_prime_UTR_variant	Exon 2 of 21	1	NM_000245.4	ENSP00000380860.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Renal cell carcinoma Uncertain:1

May 22, 2018

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant has not been reported in the literature in individuals with MET-related disease. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. The current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in MET cause disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. This variant is not present in population databases (ExAC no frequency). This variant, c.-12_17del, results in the deletion that affects the initiator methionine of the MET mRNA. The next in-frame methionine is located at codon 35. -

Hereditary cancer-predisposing syndrome Uncertain:1

Jan 06, 2021

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.-12_17del29 (p.M1?) alteration is located in coding exon 1 of the MET gene and consists of a AAACCTCTCATAATGAAGGCCCCCGCTGT to ----------------------------- substitution at nucleotide position 1. This changes the amino acid from a methionine to a (?) at the initiation codon. Sequence variations that modify the initiation codon (ATG) are expected to cause a shift in the mRNA reading frame and are typically deleterious in nature (Richards, 2015). Based on insufficient or conflicting evidence, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1562882716; hg19: chr7-116339125;