chr7-116699071-ATAAACCTCTCATAATGAAGGCCCCCGCTG-A

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_Strong

The NM_000245.4(MET):​c.-12_17delAAACCTCTCATAATGAAGGCCCCCGCTGT​(p.Met1fs) variant causes a frameshift, start lost, splice region change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

Frequency

Genomes: not found (cov: 32)

Consequence

MET
NM_000245.4 frameshift, start_lost, splice_region

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, multiple submitters, no conflicts U:2

Conservation

PhyloP100: 2.02

Publications

0 publications found
Variant links:
Genes affected
MET (HGNC:7029): (MET proto-oncogene, receptor tyrosine kinase) This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]
COMETT (HGNC:51196): (cytosolic oncogenic antisense to MET transcript) This gene encodes a natural antisense transcript highly expressed in papillary thyroid carcinomas harboring BRAF V600E mutation or RET gene rearrangements. This lncRNA induces the downstream MAPK pathway and is part of a co-expression network including different oncogenes belonging to the MAPK and PI3H/AKT pathways. In thyroid carcinomas, this gene has oncogenic properties associated with increased proliferation and drug resistance. [provided by RefSeq, Jan 2020]

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 17 pathogenic variants in the truncated region.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
METNM_000245.4 linkc.-12_17delAAACCTCTCATAATGAAGGCCCCCGCTGT p.Met1fs frameshift_variant, start_lost, splice_region_variant Exon 2 of 21 ENST00000397752.8 NP_000236.2 P08581-1A0A024R759
METNM_000245.4 linkc.-12_17delAAACCTCTCATAATGAAGGCCCCCGCTGT 5_prime_UTR_variant Exon 2 of 21 ENST00000397752.8 NP_000236.2 P08581-1A0A024R759

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
METENST00000397752.8 linkc.-12_17delAAACCTCTCATAATGAAGGCCCCCGCTGT p.Met1fs frameshift_variant, start_lost, splice_region_variant Exon 2 of 21 1 NM_000245.4 ENSP00000380860.3 P08581-1
METENST00000397752.8 linkc.-12_17delAAACCTCTCATAATGAAGGCCCCCGCTGT 5_prime_UTR_variant Exon 2 of 21 1 NM_000245.4 ENSP00000380860.3 P08581-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Renal cell carcinoma Uncertain:1
May 22, 2018
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant has not been reported in the literature in individuals with MET-related disease. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. The current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in MET cause disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. This variant is not present in population databases (ExAC no frequency). This variant, c.-12_17del, results in the deletion that affects the initiator methionine of the MET mRNA. The next in-frame methionine is located at codon 35. -

Hereditary cancer-predisposing syndrome Uncertain:1
Dec 16, 2024
Ambry Genetics
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The c.-12_17del29 alteration is located in the 5' untranslated region (5'UTR) of the MET gene. This alteration consists of a deletion of 29 nucleotides upstream from the first translated codon. Based on insufficient or conflicting evidence, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
2.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1562882716; hg19: chr7-116339125; API