NM_000245.4:c.-12_17delAAACCTCTCATAATGAAGGCCCCCGCTGT

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1PM2

The NM_000245.4(MET):​c.-12_17delAAACCTCTCATAATGAAGGCCCCCGCTGT​(p.Met1fs) variant causes a frameshift, start lost, splice region change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).

Frequency

Genomes: not found (cov: 32)

Consequence

MET
NM_000245.4 frameshift, start_lost, splice_region

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, multiple submitters, no conflicts U:2

Conservation

PhyloP100: 2.02
Variant links:
Genes affected
MET (HGNC:7029): (MET proto-oncogene, receptor tyrosine kinase) This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 10 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 27 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
METNM_000245.4 linkc.-12_17delAAACCTCTCATAATGAAGGCCCCCGCTGT p.Met1fs frameshift_variant, start_lost, splice_region_variant Exon 2 of 21 ENST00000397752.8 NP_000236.2 P08581-1A0A024R759
METNM_000245.4 linkc.-12_17delAAACCTCTCATAATGAAGGCCCCCGCTGT 5_prime_UTR_variant Exon 2 of 21 ENST00000397752.8 NP_000236.2 P08581-1A0A024R759

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
METENST00000397752.8 linkc.-12_17delAAACCTCTCATAATGAAGGCCCCCGCTGT p.Met1fs frameshift_variant, start_lost, splice_region_variant Exon 2 of 21 1 NM_000245.4 ENSP00000380860.3 P08581-1
METENST00000397752 linkc.-12_17delAAACCTCTCATAATGAAGGCCCCCGCTGT 5_prime_UTR_variant Exon 2 of 21 1 NM_000245.4 ENSP00000380860.3 P08581-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Renal cell carcinoma Uncertain:1
May 22, 2018
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This variant has not been reported in the literature in individuals with MET-related disease. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. The current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in MET cause disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. This variant is not present in population databases (ExAC no frequency). This variant, c.-12_17del, results in the deletion that affects the initiator methionine of the MET mRNA. The next in-frame methionine is located at codon 35. -

Hereditary cancer-predisposing syndrome Uncertain:1
Jan 06, 2021
Ambry Genetics
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

The c.-12_17del29 (p.M1?) alteration is located in coding exon 1 of the MET gene and consists of a AAACCTCTCATAATGAAGGCCCCCGCTGT to ----------------------------- substitution at nucleotide position 1. This changes the amino acid from a methionine to a (?) at the initiation codon. Sequence variations that modify the initiation codon (ATG) are expected to cause a shift in the mRNA reading frame and are typically deleterious in nature (Richards, 2015). Based on insufficient or conflicting evidence, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1562882716; hg19: chr7-116339125; API