7-116771970-CCGAGCTACTTTTCCAGAAGGTATATTT-C
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PVS1_Moderate
The NM_000245.4(MET):c.3011_3028+9delGAGCTACTTTTCCAGAAGGTATATTTC(p.Arg1004_Asp1010delinsHis) variant causes a splice donor, disruptive inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as risk factor (no stars). Synonymous variant affecting the same amino acid position (i.e. R1004R) has been classified as Likely benign.
Frequency
Consequence
NM_000245.4 splice_donor, disruptive_inframe_deletion, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- hereditary papillary renal cell carcinomaInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P
- papillary renal cell carcinomaInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp, ClinGen
- autosomal recessive nonsyndromic hearing loss 97Inheritance: AR Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
- osteofibrous dysplasiaInheritance: AD Classification: SUPPORTIVE, LIMITED Submitted by: Orphanet, Ambry Genetics
- hearing loss, autosomal recessiveInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- arthrogryposis, distal, IIa 11Inheritance: AD, Unknown Classification: LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
- nonsyndromic genetic hearing lossInheritance: AR Classification: LIMITED Submitted by: ClinGen
- complex neurodevelopmental disorderInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000245.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MET | MANE Select | c.3011_3028+9delGAGCTACTTTTCCAGAAGGTATATTTC | p.Arg1004_Asp1010delinsHis | splice_donor disruptive_inframe_deletion splice_region intron | Exon 14 of 21 | NP_000236.2 | |||
| MET | c.3065_3082+9delGAGCTACTTTTCCAGAAGGTATATTTC | p.Arg1022_Asp1028delinsHis | splice_donor disruptive_inframe_deletion splice_region intron | Exon 14 of 21 | NP_001120972.1 | P08581-2 | |||
| MET | c.1721_1738+9delGAGCTACTTTTCCAGAAGGTATATTTC | p.Arg574_Asp580delinsHis | splice_donor disruptive_inframe_deletion splice_region intron | Exon 13 of 20 | NP_001311331.1 | B4DLF5 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MET | TSL:1 MANE Select | c.3010_3028+8delCGAGCTACTTTTCCAGAAGGTATATTT | p.Arg1004ProfsTer379 | frameshift splice_donor splice_region intron | Exon 14 of 21 | ENSP00000380860.3 | P08581-1 | ||
| MET | TSL:1 | c.3064_3082+8delCGAGCTACTTTTCCAGAAGGTATATTT | p.Arg1022ProfsTer379 | frameshift splice_donor splice_region intron | Exon 14 of 21 | ENSP00000317272.6 | P08581-2 | ||
| MET | TSL:1 | n.*615_*633+8delCGAGCTACTTTTCCAGAAGGTATATTT | splice_region non_coding_transcript_exon | Exon 13 of 20 | ENSP00000410980.2 | P08581-3 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at