7-116771970-CCGAGCTACTTTTCCAGAAGGTATATTT-C

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_ModeratePM2

The NM_000245.4(MET):​c.3011_3028+9delGAGCTACTTTTCCAGAAGGTATATTTC​(p.Arg1004_Asp1010delinsHis) variant causes a splice donor, disruptive inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as risk factor (no stars).

Frequency

Genomes: not found (cov: 32)

Consequence

MET
NM_000245.4 splice_donor, disruptive_inframe_deletion, splice_region, intron

Scores

Not classified

Clinical Significance

risk factor no assertion criteria provided O:1

Conservation

PhyloP100: 9.33
Variant links:
Genes affected
MET (HGNC:7029): (MET proto-oncogene, receptor tyrosine kinase) This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 4 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.033549007 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
METNM_000245.4 linkuse as main transcriptc.3011_3028+9delGAGCTACTTTTCCAGAAGGTATATTTC p.Arg1004_Asp1010delinsHis splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant 14/21 ENST00000397752.8 NP_000236.2 P08581-1A0A024R759
METNM_001127500.3 linkuse as main transcriptc.3065_3082+9delGAGCTACTTTTCCAGAAGGTATATTTC p.Arg1022_Asp1028delinsHis splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant 14/21 NP_001120972.1 P08581-2A0A024R728
METNM_001324402.2 linkuse as main transcriptc.1721_1738+9delGAGCTACTTTTCCAGAAGGTATATTTC p.Arg574_Asp580delinsHis splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant 13/20 NP_001311331.1 B4DLF5
METXM_011516223.2 linkuse as main transcriptc.3068_3085+9delGAGCTACTTTTCCAGAAGGTATATTTC p.Arg1023_Asp1029delinsHis splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant 15/22 XP_011514525.1

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
METENST00000397752.8 linkuse as main transcriptc.3011_3028+9delGAGCTACTTTTCCAGAAGGTATATTTC p.Arg1004_Asp1010delinsHis splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant 14/211 NM_000245.4 ENSP00000380860.3 P08581-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: risk factor
Submissions summary: Other:1
Revision: no assertion criteria provided
LINK: link

Submissions by phenotype

Osteofibrous dysplasia Other:1
risk factor, no assertion criteria providedliterature onlyOMIMAug 23, 2016- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs869320706; hg19: chr7-116412024; API