rs869320706

Variant names:

• chr7-116771970-CCGAGCTACTTTTCCAGAAGGTATATTT-C
• rs869320706
• NM_000245.4:c.3011_3028+9delGAGCTACTTTTCCAGAAGGTATATTTC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_Moderate PM2

The NM_000245.4(MET):​c.3011_3028+9delGAGCTACTTTTCCAGAAGGTATATTTC​(p.Arg1004_Asp1010delinsHis) variant causes a splice donor, disruptive inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as risk factor (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: MET NM_000245.4 splice_donor, disruptive_inframe_deletion, splice_region, intron
• Clinical Significance: risk factor no assertion criteria provided O:1
• Conservation: PhyloP100: 9.33

Genes affected

MET (HGNC:7029): (MET proto-oncogene, receptor tyrosine kinase) This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.03378864 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MET	NM_000245.4	c.3011_3028+9delGAGCTACTTTTCCAGAAGGTATATTTC	p.Arg1004_Asp1010delinsHis	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 14 of 21	ENST00000397752.8	NP_000236.2
MET	NM_001127500.3	c.3065_3082+9delGAGCTACTTTTCCAGAAGGTATATTTC	p.Arg1022_Asp1028delinsHis	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 14 of 21		NP_001120972.1
MET	NM_001324402.2	c.1721_1738+9delGAGCTACTTTTCCAGAAGGTATATTTC	p.Arg574_Asp580delinsHis	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 13 of 20		NP_001311331.1
MET	XM_011516223.2	c.3068_3085+9delGAGCTACTTTTCCAGAAGGTATATTTC	p.Arg1023_Asp1029delinsHis	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 15 of 22		XP_011514525.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MET	ENST00000397752.8	c.3010_3028+8delCGAGCTACTTTTCCAGAAGGTATATTT	p.Arg1004ProfsTer379	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 14 of 21	1	NM_000245.4	ENSP00000380860.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: risk factor

Submissions summary: Other:1

Revision: no assertion criteria provided

Submissions by phenotype

Osteofibrous dysplasia Other:1

Aug 23, 2016

OMIM

Significance: risk factor

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs869320706; hg19: chr7-116412024;