7-117603732-TACATTCTGTTCTTCAAGCACCTATGTCAACCC-T

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong

The NM_000492.4(CFTR):​c.2859_2890delACATTCTGTTCTTCAAGCACCTATGTCAACCC​(p.Leu953PhefsTer11) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★). Synonymous variant affecting the same amino acid position (i.e. L953L) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

CFTR
NM_000492.4 frameshift

Scores

Not classified

Clinical Significance

Pathogenic reviewed by expert panel P:6

Conservation

PhyloP100: 7.82

Publications

2 publications found
Variant links:
Genes affected
CFTR (HGNC:1884): (CF transmembrane conductance regulator) This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. The encoded protein functions as a chloride channel, making it unique among members of this protein family, and controls ion and water secretion and absorption in epithelial tissues. Channel activation is mediated by cycles of regulatory domain phosphorylation, ATP-binding by the nucleotide-binding domains, and ATP hydrolysis. Mutations in this gene cause cystic fibrosis, the most common lethal genetic disorder in populations of Northern European descent. The most frequently occurring mutation in cystic fibrosis, DeltaF508, results in impaired folding and trafficking of the encoded protein. Multiple pseudogenes have been identified in the human genome. [provided by RefSeq, Aug 2017]
CFTR Gene-Disease associations (from GenCC):
  • cystic fibrosis
    Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), Myriad Women’s Health, Orphanet
  • congenital bilateral absence of vas deferens
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • hereditary chronic pancreatitis
    Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 16 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 7-117603732-TACATTCTGTTCTTCAAGCACCTATGTCAACCC-T is Pathogenic according to our data. Variant chr7-117603732-TACATTCTGTTCTTCAAGCACCTATGTCAACCC-T is described in ClinVar as Pathogenic. ClinVar VariationId is 53581.Status of the report is reviewed_by_expert_panel, 3 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
CFTRNM_000492.4 linkc.2859_2890delACATTCTGTTCTTCAAGCACCTATGTCAACCC p.Leu953PhefsTer11 frameshift_variant Exon 17 of 27 ENST00000003084.11 NP_000483.3 P13569-1A0A024R730

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
CFTRENST00000003084.11 linkc.2859_2890delACATTCTGTTCTTCAAGCACCTATGTCAACCC p.Leu953PhefsTer11 frameshift_variant Exon 17 of 27 1 NM_000492.4 ENSP00000003084.6 P13569-1

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD2 exomes
AF:
0.00000398
AC:
1
AN:
251370
AF XY:
0.00000736
show subpopulations
Gnomad AFR exome
AF:
0.00
Gnomad AMR exome
AF:
0.00
Gnomad ASJ exome
AF:
0.00
Gnomad EAS exome
AF:
0.00
Gnomad FIN exome
AF:
0.00
Gnomad NFE exome
AF:
0.00000879
Gnomad OTH exome
AF:
0.00
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:6
Revision: reviewed by expert panel
LINK: link

Submissions by phenotype

Cystic fibrosis Pathogenic:5
Mar 17, 2017
CFTR2
Significance:Pathogenic
Review Status:reviewed by expert panel
Collection Method:research

- -

Nov 05, 2018
Mendelics
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Jun 15, 2022
Ambry Genetics
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The c.2859_2890del32 pathogenic mutation, located in coding exon 17 of the CFTR gene, results from a deletion of 32 nucleotides at nucleotide positions 2859 to 2890, causing a translational frameshift with a predicted alternate stop codon (p.L953Ffs*11). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Sep 05, 2022
Institute of Human Genetics, University of Leipzig Medical Center
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:curation

This variant was identified in 6 unrelated patients with a clinically confirmed diagnosis of cystic fibrosis. The variant was classified in the context of a project re-classifying variants in the German Cystic Fibrosis Registry (Muko.e.V.). Link: https://www.muko.info/angebote/qualitaetsmanagement/register/cf-einrichtungen/mukoweb. Criteria applied: PVS1, PS3_SUP, PM2_SUP, PM3_STR, PP4 -

May 28, 2022
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This sequence change creates a premature translational stop signal (p.Leu953Phefs*11) in the CFTR gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in CFTR are known to be pathogenic (PMID: 1695717, 7691345, 9725922). For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 53581). This premature translational stop signal has been observed in individual(s) with cystic fibrosis (PMID: 7519167). This variant is present in population databases (rs397508445, gnomAD 0.0009%). -

CFTR-related disorder Pathogenic:1
Aug 10, 2020
Natera, Inc.
Significance:Pathogenic
Review Status:no assertion criteria provided
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
7.8
Mutation Taster
=0/200
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs397508445; hg19: chr7-117243786; API