NM_000492.4:c.2859_2890delACATTCTGTTCTTCAAGCACCTATGTCAACCC
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000492.4(CFTR):c.2859_2890delACATTCTGTTCTTCAAGCACCTATGTCAACCC(p.Leu953PhefsTer11) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★). Synonymous variant affecting the same amino acid position (i.e. L953L) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000492.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- cystic fibrosisInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), Myriad Women’s Health, Orphanet
- congenital bilateral absence of vas deferensInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- hereditary chronic pancreatitisInheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| CFTR | NM_000492.4 | c.2859_2890delACATTCTGTTCTTCAAGCACCTATGTCAACCC | p.Leu953PhefsTer11 | frameshift_variant | Exon 17 of 27 | ENST00000003084.11 | NP_000483.3 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD2 exomes AF: 0.00000398 AC: 1AN: 251370 AF XY: 0.00000736 show subpopulations
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Cystic fibrosis Pathogenic:5
- -
- -
The c.2859_2890del32 pathogenic mutation, located in coding exon 17 of the CFTR gene, results from a deletion of 32 nucleotides at nucleotide positions 2859 to 2890, causing a translational frameshift with a predicted alternate stop codon (p.L953Ffs*11). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -
This variant was identified in 6 unrelated patients with a clinically confirmed diagnosis of cystic fibrosis. The variant was classified in the context of a project re-classifying variants in the German Cystic Fibrosis Registry (Muko.e.V.). Link: https://www.muko.info/angebote/qualitaetsmanagement/register/cf-einrichtungen/mukoweb. Criteria applied: PVS1, PS3_SUP, PM2_SUP, PM3_STR, PP4 -
This sequence change creates a premature translational stop signal (p.Leu953Phefs*11) in the CFTR gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in CFTR are known to be pathogenic (PMID: 1695717, 7691345, 9725922). For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 53581). This premature translational stop signal has been observed in individual(s) with cystic fibrosis (PMID: 7519167). This variant is present in population databases (rs397508445, gnomAD 0.0009%). -
CFTR-related disorder Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at