chr7-117603732-TACATTCTGTTCTTCAAGCACCTATGTCAACCC-T

Variant names:

• chr7-117603732-TACATTCTGTTCTTCAAGCACCTATGTCAACCC-T
• rs397508445
• NM_000492.4:c.2859_2890delACATTCTGTTCTTCAAGCACCTATGTCAACCC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000492.4(CFTR):​c.2859_2890delACATTCTGTTCTTCAAGCACCTATGTCAACCC​(p.Leu953PhefsTer11) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★). Synonymous variant affecting the same amino acid position (i.e. L953L) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CFTR NM_000492.4 frameshift
• Clinical Significance: Pathogenic reviewed by expert panel P:6
• Conservation: PhyloP100: 7.82
• Publications: 2 publications found

Genes affected

CFTR (HGNC:1884): (CF transmembrane conductance regulator) This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. The encoded protein functions as a chloride channel, making it unique among members of this protein family, and controls ion and water secretion and absorption in epithelial tissues. Channel activation is mediated by cycles of regulatory domain phosphorylation, ATP-binding by the nucleotide-binding domains, and ATP hydrolysis. Mutations in this gene cause cystic fibrosis, the most common lethal genetic disorder in populations of Northern European descent. The most frequently occurring mutation in cystic fibrosis, DeltaF508, results in impaired folding and trafficking of the encoded protein. Multiple pseudogenes have been identified in the human genome. [provided by RefSeq, Aug 2017]

CFTR Gene-Disease associations (from GenCC):

• cystic fibrosis

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), Myriad Women’s Health, Orphanet
• congenital bilateral absence of vas deferens

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• hereditary chronic pancreatitis

  Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 7-117603732-TACATTCTGTTCTTCAAGCACCTATGTCAACCC-T is Pathogenic according to our data. Variant chr7-117603732-TACATTCTGTTCTTCAAGCACCTATGTCAACCC-T is described in ClinVar as Pathogenic. ClinVar VariationId is 53581.Status of the report is reviewed_by_expert_panel, 3 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CFTR	NM_000492.4	c.2859_2890delACATTCTGTTCTTCAAGCACCTATGTCAACCC	p.Leu953PhefsTer11	frameshift_variant	Exon 17 of 27	ENST00000003084.11	NP_000483.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CFTR	ENST00000003084.11	c.2859_2890delACATTCTGTTCTTCAAGCACCTATGTCAACCC	p.Leu953PhefsTer11	frameshift_variant	Exon 17 of 27	1	NM_000492.4	ENSP00000003084.6

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD2 exomes AF: 0.00000398 AC: 1 AN: 251370 AF XY: 0.00000736

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000879

Gnomad OTH exome AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:6

Revision: reviewed by expert panel

Submissions by phenotype

Cystic fibrosis Pathogenic:5

Mar 17, 2017

CFTR2

Significance: Pathogenic

Review Status: reviewed by expert panel

Collection Method: research

- -

Nov 05, 2018

Mendelics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Jun 15, 2022

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.2859_2890del32 pathogenic mutation, located in coding exon 17 of the CFTR gene, results from a deletion of 32 nucleotides at nucleotide positions 2859 to 2890, causing a translational frameshift with a predicted alternate stop codon (p.L953Ffs*11). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Sep 05, 2022

Institute of Human Genetics, University of Leipzig Medical Center

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: curation

This variant was identified in 6 unrelated patients with a clinically confirmed diagnosis of cystic fibrosis. The variant was classified in the context of a project re-classifying variants in the German Cystic Fibrosis Registry (Muko.e.V.). Link: https://www.muko.info/angebote/qualitaetsmanagement/register/cf-einrichtungen/mukoweb. Criteria applied: PVS1, PS3_SUP, PM2_SUP, PM3_STR, PP4 -

May 28, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Leu953Phefs*11) in the CFTR gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in CFTR are known to be pathogenic (PMID: 1695717, 7691345, 9725922). For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 53581). This premature translational stop signal has been observed in individual(s) with cystic fibrosis (PMID: 7519167). This variant is present in population databases (rs397508445, gnomAD 0.0009%). -

CFTR-related disorder Pathogenic:1

Aug 10, 2020

Natera, Inc.

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.8
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397508445; hg19: chr7-117243786;