7-135570871-A-ATATATGTAATATATTATATATTATATATT

Variant names:

• chr7-135570871-A-ATATATGTAATATATTATATATTATATATT
• rs1491577075
• NM_015135.3:c.29-228_29-200dupGTAATATATTATATATTATATATTTATAT

Variant summary

Our verdict is Benign. Variant got -10 ACMG points: 0P and 10B. BP6_Moderate BA1

The NM_015135.3(NUP205):​c.29-228_29-200dupGTAATATATTATATATTATATATTTATAT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0856 in 102,606 control chromosomes in the GnomAD database, including 1,222 homozygotes. Variant has been reported in ClinVar as Benign (★).

• Frequency: Genomes: 𝑓 0.086 (1222 hom., cov: 21)
• Consequence: NUP205 NM_015135.3 intron
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.00

Genes affected

NUP205 (HGNC:18658): (nucleoporin 205) This gene encodes a nucleoporin, which is a subunit of the nuclear pore complex that functions in active transport of proteins, RNAs and ribonucleoprotein particles between the nucleus and cytoplasm. Mutations in this gene are associated with steroid-resistant nephrotic syndrome. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -10 ACMG points.

• BP6: Variant 7-135570871-A-ATATATGTAATATATTATATATTATATATT is Benign according to our data. Variant chr7-135570871-A-ATATATGTAATATATTATATATTATATATT is described in ClinVar as [Benign]. Clinvar id is 1245148.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (EAS) allele frequency at 95% confidence interval = 0.152 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
NUP205	NM_015135.3	c.29-228_29-200dupGTAATATATTATATATTATATATTTATAT		intron_variant	Intron 1 of 42	ENST00000285968.11	NP_055950.2
NUP205	NM_001329434.2	c.-1057-228_-1057-200dupGTAATATATTATATATTATATATTTATAT		intron_variant	Intron 1 of 42		NP_001316363.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
NUP205	ENST00000285968.11	c.29-234_29-233insTATATGTAATATATTATATATTATATATT		intron_variant	Intron 1 of 42	1	NM_015135.3	ENSP00000285968.6
NUP205	ENST00000489493.1	n.284-234_284-233insTATATGTAATATATTATATATTATATATT		intron_variant	Intron 1 of 2	4

Frequencies

GnomAD3 genomes AF: 0.0856 AC: 8785 AN: 102600 Hom.: 1221 Cov.: 21

Gnomad AFR AF: 0.0303

Gnomad AMI AF: 0.202

Gnomad AMR AF: 0.0662

Gnomad ASJ AF: 0.0717

Gnomad EAS AF: 0.161

Gnomad SAS AF: 0.0866

Gnomad FIN AF: 0.0452

Gnomad MID AF: 0.0336

Gnomad NFE AF: 0.114

Gnomad OTH AF: 0.0678

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.0856 AC: 8783 AN: 102606 Hom.: 1222 Cov.: 21 AF XY: 0.0772 AC XY: 3597 AN XY: 46566

Gnomad4 AFR AF: 0.0303

Gnomad4 AMR AF: 0.0662

Gnomad4 ASJ AF: 0.0717

Gnomad4 EAS AF: 0.162

Gnomad4 SAS AF: 0.0863

Gnomad4 FIN AF: 0.0452

Gnomad4 NFE AF: 0.114

Gnomad4 OTH AF: 0.0673

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Dec 18, 2019

GeneDx

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1491577075; hg19: chr7-135255619;