chr7-135570871-A-ATATATGTAATATATTATATATTATATATT

Variant names:

• chr7-135570871-A-ATATATGTAATATATTATATATTATATATT
• rs1491577075
• NM_015135.3:c.29-228_29-200dupGTAATATATTATATATTATATATTTATAT

Variant summary

Our verdict is Benign. The variant received -10 ACMG points: 0P and 10B. BP6_Moderate BA1

The NM_015135.3(NUP205):​c.29-228_29-200dupGTAATATATTATATATTATATATTTATAT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0856 in 102,606 control chromosomes in the GnomAD database, including 1,222 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).

• Frequency: Genomes: 𝑓 0.086 (1222 hom., cov: 21)
• Consequence: NUP205 NM_015135.3 intron
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.00
• Publications: 0 publications found

Genes affected

NUP205 (HGNC:18658): (nucleoporin 205) This gene encodes a nucleoporin, which is a subunit of the nuclear pore complex that functions in active transport of proteins, RNAs and ribonucleoprotein particles between the nucleus and cytoplasm. Mutations in this gene are associated with steroid-resistant nephrotic syndrome. [provided by RefSeq, Jul 2016]

NUP205 Gene-Disease associations (from GenCC):

• nephrotic syndrome, type 13

  Inheritance: AR Classification: STRONG, LIMITED Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae)
• familial idiopathic steroid-resistant nephrotic syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -10 ACMG points.

• BP6: Variant 7-135570871-A-ATATATGTAATATATTATATATTATATATT is Benign according to our data. Variant chr7-135570871-A-ATATATGTAATATATTATATATTATATATT is described in ClinVar as Benign. ClinVar VariationId is 1245148.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (EAS) allele frequency at 95% confidence interval = 0.152 is higher than 0.05.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_015135.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NUP205	NM_015135.3	MANE Select	c.29-228_29-200dupGTAATATATTATATATTATATATTTATAT		intron	N/A	NP_055950.2	Q92621
	NUP205	NM_001329434.2		c.-1057-228_-1057-200dupGTAATATATTATATATTATATATTTATAT		intron	N/A	NP_001316363.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NUP205	ENST00000285968.11	TSL:1 MANE Select	c.29-234_29-233insTATATGTAATATATTATATATTATATATT		intron	N/A	ENSP00000285968.6	Q92621
	NUP205	ENST00000921555.1		c.125-234_125-233insTATATGTAATATATTATATATTATATATT		intron	N/A	ENSP00000591614.1
	NUP205	ENST00000921547.1		c.29-234_29-233insTATATGTAATATATTATATATTATATATT		intron	N/A	ENSP00000591606.1

Frequencies

GnomAD3 genomes AF: 0.0856 AC: 8785 AN: 102600 Hom.: 1221 Cov.: 21

Gnomad AFR AF: 0.0303

Gnomad AMI AF: 0.202

Gnomad AMR AF: 0.0662

Gnomad ASJ AF: 0.0717

Gnomad EAS AF: 0.161

Gnomad SAS AF: 0.0866

Gnomad FIN AF: 0.0452

Gnomad MID AF: 0.0336

Gnomad NFE AF: 0.114

Gnomad OTH AF: 0.0678

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.0856 AC: 8783 AN: 102606 Hom.: 1222 Cov.: 21 AF XY: 0.0772 AC XY: 3597 AN XY: 46566

African (AFR) AF: 0.0303 AC: 839 AN: 27722

American (AMR) AF: 0.0662 AC: 506 AN: 7640

Ashkenazi Jewish (ASJ) AF: 0.0717 AC: 207 AN: 2886

East Asian (EAS) AF: 0.162 AC: 657 AN: 4060

South Asian (SAS) AF: 0.0863 AC: 312 AN: 3616

European-Finnish (FIN) AF: 0.0452 AC: 116 AN: 2568

Middle Eastern (MID) AF: 0.0364 AC: 8 AN: 220

European-Non Finnish (NFE) AF: 0.114 AC: 5931 AN: 52016

Other (OTH) AF: 0.0673 AC: 86 AN: 1278

Alfa AF: 0.0476 Hom.: 126

ClinVar

ClinVar submissions

Significance: Benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.0
Mutation Taster		=100/0	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1491577075; hg19: chr7-135255619;