7-155803238-G-GGGCCGTGAGCGGCGCGTAGGC

Position:

• chr7-155803238-G-GGGCCGTGAGCGGCGCGTAGGC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_000193.4(SHH):​c.1030_1050dupGCCTACGCGCCGCTCACGGCC​(p.Ala350_Gln351insAlaTyrAlaProLeuThrAla) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: SHH NM_000193.4 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: -0.0740

Genes affected

SHH (HGNC:10848): (sonic hedgehog signaling molecule) This gene encodes a protein that is instrumental in patterning the early embryo. It has been implicated as the key inductive signal in patterning of the ventral neural tube, the anterior-posterior limb axis, and the ventral somites. Of three human proteins showing sequence and functional similarity to the sonic hedgehog protein of Drosophila, this protein is the most similar. The protein is made as a precursor that is autocatalytically cleaved; the N-terminal portion is soluble and contains the signalling activity while the C-terminal portion is involved in precursor processing. More importantly, the C-terminal product covalently attaches a cholesterol moiety to the N-terminal product, restricting the N-terminal product to the cell surface and preventing it from freely diffusing throughout the developing embryo. Defects in this protein or in its signalling pathway are a cause of holoprosencephaly (HPE), a disorder in which the developing forebrain fails to correctly separate into right and left hemispheres. HPE is manifested by facial deformities. It is also thought that mutations in this gene or in its signalling pathway may be responsible for VACTERL syndrome, which is characterized by vertebral defects, anal atresia, tracheoesophageal fistula with esophageal atresia, radial and renal dysplasia, cardiac anomalies, and limb abnormalities. Additionally, mutations in a long range enhancer located approximately 1 megabase upstream of this gene disrupt limb patterning and can result in preaxial polydactyly. [provided by RefSeq, Jul 2008]

SHH (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000193.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
SHH	NM_000193.4	c.1030_1050dupGCCTACGCGCCGCTCACGGCC	p.Ala350_Gln351insAlaTyrAlaProLeuThrAla	conservative_inframe_insertion	3/3	ENST00000297261.7	NP_000184.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
SHH	ENST00000297261.7	c.1030_1050dupGCCTACGCGCCGCTCACGGCC	p.Ala350_Gln351insAlaTyrAlaProLeuThrAla	conservative_inframe_insertion	3/3	1	NM_000193.4	ENSP00000297261.2
SHH	ENST00000430104.5	c.302-3014_302-2994dupGCCTACGCGCCGCTCACGGCC		intron_variant		1		ENSP00000396621.1
SHH	ENST00000435425.1	n.302-2662_302-2642dupGCCTACGCGCCGCTCACGGCC		intron_variant		1		ENSP00000413871.1
SHH	ENST00000441114.5	n.302-2592_302-2572dupGCCTACGCGCCGCTCACGGCC		intron_variant		1		ENSP00000410546.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 35

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Genetic Services Laboratory, University of Chicago

Oct 05, 2015

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554493741; hg19: chr7-155595932;