7-155803238-G-GGGCCGTGAGCGGCGCGTAGGC

Variant names:

• chr7-155803238-G-GGGCCGTGAGCGGCGCGTAGGC
• rs1554493741
• NM_000193.4:c.1030_1050dupGCCTACGCGCCGCTCACGGCC

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM1 PM4

The NM_000193.4(SHH):​c.1030_1050dupGCCTACGCGCCGCTCACGGCC​(p.Ala350_Gln351insAlaTyrAlaProLeuThrAla) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: SHH NM_000193.4 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: -0.0740
• Publications: 0 publications found

Genes affected

SHH (HGNC:10848): (sonic hedgehog signaling molecule) This gene encodes a protein that is instrumental in patterning the early embryo. It has been implicated as the key inductive signal in patterning of the ventral neural tube, the anterior-posterior limb axis, and the ventral somites. Of three human proteins showing sequence and functional similarity to the sonic hedgehog protein of Drosophila, this protein is the most similar. The protein is made as a precursor that is autocatalytically cleaved; the N-terminal portion is soluble and contains the signalling activity while the C-terminal portion is involved in precursor processing. More importantly, the C-terminal product covalently attaches a cholesterol moiety to the N-terminal product, restricting the N-terminal product to the cell surface and preventing it from freely diffusing throughout the developing embryo. Defects in this protein or in its signalling pathway are a cause of holoprosencephaly (HPE), a disorder in which the developing forebrain fails to correctly separate into right and left hemispheres. HPE is manifested by facial deformities. It is also thought that mutations in this gene or in its signalling pathway may be responsible for VACTERL syndrome, which is characterized by vertebral defects, anal atresia, tracheoesophageal fistula with esophageal atresia, radial and renal dysplasia, cardiac anomalies, and limb abnormalities. Additionally, mutations in a long range enhancer located approximately 1 megabase upstream of this gene disrupt limb patterning and can result in preaxial polydactyly. [provided by RefSeq, Jul 2008]

SHH Gene-Disease associations (from GenCC):

• holoprosencephaly 3

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• microphthalmia, isolated, with coloboma 5

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, PanelApp Australia
• polydactyly of a triphalangeal thumb

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• solitary median maxillary central incisor syndrome

  Inheritance: AD Classification: DEFINITIVE, MODERATE Submitted by: G2P, Ambry Genetics
• skeletal system disorder

  Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
• autosomal dominant preaxial polydactyly-upperback hypertrichosis syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• hypoplastic tibiae-postaxial polydactyly syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• microphthalmia, isolated, with coloboma

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• syndactyly type 4

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• triphalangeal thumb-polysyndactyly syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• holoprosencephaly

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM1: In a hotspot region, there are 7 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 7 uncertain in NM_000193.4
• PM4: Nonframeshift variant in NON repetitive region in NM_000193.4.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000193.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SHH	NM_000193.4	MANE Select	c.1030_1050dupGCCTACGCGCCGCTCACGGCC	p.Ala350_Gln351insAlaTyrAlaProLeuThrAla	conservative_inframe_insertion	Exon 3 of 3	NP_000184.1
	SHH	NM_001310462.2		c.302-3014_302-2994dupGCCTACGCGCCGCTCACGGCC		intron	N/A	NP_001297391.1
	SHH	NR_132318.2		n.563-2592_563-2572dupGCCTACGCGCCGCTCACGGCC		intron	N/A

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SHH	ENST00000297261.7	TSL:1 MANE Select	c.1030_1050dupGCCTACGCGCCGCTCACGGCC	p.Ala350_Gln351insAlaTyrAlaProLeuThrAla	conservative_inframe_insertion	Exon 3 of 3	ENSP00000297261.2
	SHH	ENST00000430104.5	TSL:1	c.302-3014_302-2994dupGCCTACGCGCCGCTCACGGCC		intron	N/A	ENSP00000396621.1
	SHH	ENST00000435425.1	TSL:1	n.302-2662_302-2642dupGCCTACGCGCCGCTCACGGCC		intron	N/A	ENSP00000413871.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 35

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Uncertain:1

Oct 05, 2015

Genetic Services Laboratory, University of Chicago

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.074

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554493741; hg19: chr7-155595932;