7-19116906-GGCAGCGTGGGGATGATCTTCC-GGCAGCGTGGGGATGATCTTCCGCAGCGTGGGGATGATCTTCC

Variant names:

• chr7-19116906-G-GGCAGCGTGGGGATGATCTTCC
• rs1554441992
• NM_000474.4:c.395_415dupGGAAGATCATCCCCACGCTGC

Variant summary

Our verdict is Likely pathogenic. The variant received 7 ACMG points: 7P and 0B. PM1 PM4 PP3 PP5_Moderate

The NM_000474.4(TWIST1):​c.395_415dupGGAAGATCATCCCCACGCTGC​(p.Arg132_Leu138dup) variant causes a conservative inframe insertion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: TWIST1 NM_000474.4 conservative_inframe_insertion
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.83
• Publications: 0 publications found

Genes affected

TWIST1 (HGNC:12428): (twist family bHLH transcription factor 1) This gene encodes a basic helix-loop-helix (bHLH) transcription factor that plays an important role in embryonic development. The encoded protein forms both homodimers and heterodimers that bind to DNA E box sequences and regulate the transcription of genes involved in cranial suture closure during skull development. This protein may also regulate neural tube closure, limb development and brown fat metabolism. This gene is hypermethylated and overexpressed in multiple human cancers, and the encoded protein promotes tumor cell invasion and metastasis, as well as metastatic recurrence. Mutations in this gene cause Saethre-Chotzen syndrome in human patients, which is characterized by craniosynostosis, ptosis and hypertelorism. [provided by RefSeq, Jul 2020]

TWIST1 Gene-Disease associations (from GenCC):

• Saethre-Chotzen syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, G2P, PanelApp Australia, Laboratory for Molecular Medicine, ClinGen, Orphanet, Labcorp Genetics (formerly Invitae)
• TWIST1-related craniosynostosis

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: PanelApp Australia, Labcorp Genetics (formerly Invitae), ClinGen, Genomics England PanelApp
• isolated brachycephaly

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• isolated plagiocephaly

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• isolated scaphocephaly

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Sweeney-Cox syndrome

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Likely_pathogenic. The variant received 7 ACMG points.

• PM1: In a hotspot region, there are 8 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 7 uncertain in NM_000474.4
• PM4: Nonframeshift variant in NON repetitive region in NM_000474.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 7-19116906-G-GGCAGCGTGGGGATGATCTTCC is Pathogenic according to our data. Variant chr7-19116906-G-GGCAGCGTGGGGATGATCTTCC is described in ClinVar as Pathogenic. ClinVar VariationId is 1457074.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TWIST1	NM_000474.4	c.395_415dupGGAAGATCATCCCCACGCTGC	p.Arg132_Leu138dup	conservative_inframe_insertion	Exon 1 of 2	ENST00000242261.6	NP_000465.1
TWIST1	NR_149001.2	n.710_730dupGGAAGATCATCCCCACGCTGC		non_coding_transcript_exon_variant	Exon 1 of 3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TWIST1	ENST00000242261.6	c.395_415dupGGAAGATCATCCCCACGCTGC	p.Arg132_Leu138dup	conservative_inframe_insertion	Exon 1 of 2	1	NM_000474.4	ENSP00000242261.5
TWIST1	ENST00000354571.5	n.191_211dupGGAAGATCATCCCCACGCTGC		non_coding_transcript_exon_variant	Exon 1 of 3	2		ENSP00000346582.5
TWIST1	ENST00000443687.5	n.-5_16dupGGAAGATCATCCCCACGCTGC		non_coding_transcript_exon_variant	Exon 1 of 4	4		ENSP00000416986.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Saethre-Chotzen syndrome;C4551902:TWIST1-related craniosynostosis Pathogenic:1

Dec 30, 2020

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. This variant is located in a region of the TWIST1 protein where a significant number of previously reported TWIST1 in-frame insertion variants are found (PMID: 8988166, 16838304, 26114524, 31754721). These observations suggest that this may be a clinically significant region of the protein. This variant has been observed in individual(s) with TWIST1-related conditions (PMID: 21520333, Invitae). In at least one individual the variant was observed to be de novo. This variant is not present in population databases (ExAC no frequency). This variant, c.395_415dup, results in the insertion of 7 amino acid(s) to the TWIST1 protein (p.Arg132_Leu138dup), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554441992; hg19: chr7-19156529;