rs1554441992

Positions:

• chr7-19116906-GGCAGCGTGGGGATGATCTTCC-G
• chr7-19116906-GGCAGCGTGGGGATGATCTTCC-GGCAGCGTGGGGATGATCTTCCGCAGCGTGGGGATGATCTTCC

Variant summary

Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PM1 PM2 PM4 PP3

The NM_000474.4(TWIST1):​c.395_415delGGAAGATCATCCCCACGCTGC​(p.Arg132_Leu138del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: TWIST1 NM_000474.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 9.83

Genes affected

TWIST1 (HGNC:12428): (twist family bHLH transcription factor 1) This gene encodes a basic helix-loop-helix (bHLH) transcription factor that plays an important role in embryonic development. The encoded protein forms both homodimers and heterodimers that bind to DNA E box sequences and regulate the transcription of genes involved in cranial suture closure during skull development. This protein may also regulate neural tube closure, limb development and brown fat metabolism. This gene is hypermethylated and overexpressed in multiple human cancers, and the encoded protein promotes tumor cell invasion and metastasis, as well as metastatic recurrence. Mutations in this gene cause Saethre-Chotzen syndrome in human patients, which is characterized by craniosynostosis, ptosis and hypertelorism. [provided by RefSeq, Jul 2020]

TWIST1 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 7 ACMG points.

• PM1: In a domain bHLH (size 51) in uniprot entity TWST1_HUMAN there are 15 pathogenic changes around while only 0 benign (100%) in NM_000474.4
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000474.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
TWIST1	NM_000474.4	c.395_415delGGAAGATCATCCCCACGCTGC	p.Arg132_Leu138del	disruptive_inframe_deletion	1/2	ENST00000242261.6	NP_000465.1
TWIST1	NR_149001.2	n.710_730delGGAAGATCATCCCCACGCTGC		non_coding_transcript_exon_variant	1/3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
TWIST1	ENST00000242261.6	c.395_415delGGAAGATCATCCCCACGCTGC	p.Arg132_Leu138del	disruptive_inframe_deletion	1/2	1	NM_000474.4	ENSP00000242261.5

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Saethre-Chotzen syndrome;C4551902:TWIST1-related craniosynostosis Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jul 14, 2021

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554441992; hg19: chr7-19156529;