NM_000474.4:c.395_415dupGGAAGATCATCCCCACGCTGC

Variant summary

Our verdict is Likely pathogenic. The variant received 7 ACMG points: 7P and 0B. PM1PM4PP3PP5_Moderate

The NM_000474.4(TWIST1):​c.395_415dupGGAAGATCATCCCCACGCTGC​(p.Arg132_Leu138dup) variant causes a conservative inframe insertion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 32)

Consequence

TWIST1
NM_000474.4 conservative_inframe_insertion

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 9.83

Publications

0 publications found
Variant links:
Genes affected
TWIST1 (HGNC:12428): (twist family bHLH transcription factor 1) This gene encodes a basic helix-loop-helix (bHLH) transcription factor that plays an important role in embryonic development. The encoded protein forms both homodimers and heterodimers that bind to DNA E box sequences and regulate the transcription of genes involved in cranial suture closure during skull development. This protein may also regulate neural tube closure, limb development and brown fat metabolism. This gene is hypermethylated and overexpressed in multiple human cancers, and the encoded protein promotes tumor cell invasion and metastasis, as well as metastatic recurrence. Mutations in this gene cause Saethre-Chotzen syndrome in human patients, which is characterized by craniosynostosis, ptosis and hypertelorism. [provided by RefSeq, Jul 2020]
TWIST1 Gene-Disease associations (from GenCC):
  • Saethre-Chotzen syndrome
    Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, G2P, PanelApp Australia, Laboratory for Molecular Medicine, ClinGen, Orphanet, Labcorp Genetics (formerly Invitae)
  • TWIST1-related craniosynostosis
    Inheritance: AD Classification: STRONG, MODERATE Submitted by: PanelApp Australia, Labcorp Genetics (formerly Invitae), ClinGen, Genomics England PanelApp
  • isolated brachycephaly
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • isolated plagiocephaly
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • isolated scaphocephaly
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • Sweeney-Cox syndrome
    Inheritance: AD Classification: LIMITED Submitted by: ClinGen

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Likely_pathogenic. The variant received 7 ACMG points.

PM1
In a hotspot region, there are 8 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 7 uncertain in NM_000474.4
PM4
Nonframeshift variant in NON repetitive region in NM_000474.4.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
PP5
Variant 7-19116906-G-GGCAGCGTGGGGATGATCTTCC is Pathogenic according to our data. Variant chr7-19116906-G-GGCAGCGTGGGGATGATCTTCC is described in ClinVar as Pathogenic. ClinVar VariationId is 1457074.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
TWIST1NM_000474.4 linkc.395_415dupGGAAGATCATCCCCACGCTGC p.Arg132_Leu138dup conservative_inframe_insertion Exon 1 of 2 ENST00000242261.6 NP_000465.1
TWIST1NR_149001.2 linkn.710_730dupGGAAGATCATCCCCACGCTGC non_coding_transcript_exon_variant Exon 1 of 3

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
TWIST1ENST00000242261.6 linkc.395_415dupGGAAGATCATCCCCACGCTGC p.Arg132_Leu138dup conservative_inframe_insertion Exon 1 of 2 1 NM_000474.4 ENSP00000242261.5
TWIST1ENST00000354571.5 linkn.191_211dupGGAAGATCATCCCCACGCTGC non_coding_transcript_exon_variant Exon 1 of 3 2 ENSP00000346582.5
TWIST1ENST00000443687.5 linkn.-5_16dupGGAAGATCATCCCCACGCTGC non_coding_transcript_exon_variant Exon 1 of 4 4 ENSP00000416986.1

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
32
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Saethre-Chotzen syndrome;C4551902:TWIST1-related craniosynostosis Pathogenic:1
Dec 30, 2020
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

For these reasons, this variant has been classified as Pathogenic. This variant is located in a region of the TWIST1 protein where a significant number of previously reported TWIST1 in-frame insertion variants are found (PMID: 8988166, 16838304, 26114524, 31754721). These observations suggest that this may be a clinically significant region of the protein. This variant has been observed in individual(s) with TWIST1-related conditions (PMID: 21520333, Invitae). In at least one individual the variant was observed to be de novo. This variant is not present in population databases (ExAC no frequency). This variant, c.395_415dup, results in the insertion of 7 amino acid(s) to the TWIST1 protein (p.Arg132_Leu138dup), but otherwise preserves the integrity of the reading frame.

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1554441992; hg19: chr7-19156529; API