7-6005947-GCTTAGACTCAGTACCACCTGCCCAGAGCAAATCTGATGGACTGACTTCCGATCAATAGGTTTGATGGCCTTAGCAGGTTCTGTACTAGAGAAATCA-GATTT

Position:

• chr7-6005947-GCTTAGACTCAGTACCACCTGCCCAGAGCAAATCTGATGGACTGACTTCCGATCAATAGGTTTGATGGCCTTAGCAGGTTCTGTACTAGAGAAATCA-GATTT

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_000535.7(PMS2):​c.24-12_107delinsAAAT variant causes a splice acceptor, coding sequence, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: PMS2 NM_000535.7 splice_acceptor, coding_sequence, intron
• Clinical Significance: Pathogenic reviewed by expert panel P:7
• Conservation: PhyloP100: 8.91

Genes affected

PMS2 (HGNC:9122): (PMS1 homolog 2, mismatch repair system component) The protein encoded by this gene is a key component of the mismatch repair system that functions to correct DNA mismatches and small insertions and deletions that can occur during DNA replication and homologous recombination. This protein forms heterodimers with the gene product of the mutL homolog 1 (MLH1) gene to form the MutL-alpha heterodimer. The MutL-alpha heterodimer possesses an endonucleolytic activity that is activated following recognition of mismatches and insertion/deletion loops by the MutS-alpha and MutS-beta heterodimers, and is necessary for removal of the mismatched DNA. There is a DQHA(X)2E(X)4E motif found at the C-terminus of the protein encoded by this gene that forms part of the active site of the nuclease. Mutations in this gene have been associated with hereditary nonpolyposis colorectal cancer (HNPCC; also known as Lynch syndrome) and Turcot syndrome. [provided by RefSeq, Apr 2016]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 7-6005948-CTTAGACTCAGTACCACCTGCCCAGAGCAAATCTGATGGACTGACTTCCGATCAATAGGTTTGATGGCCTTAGCAGGTTCTGTACTAGAGAAATCA-ATTT is Pathogenic according to our data. Variant chr7-6005948-CTTAGACTCAGTACCACCTGCCCAGAGCAAATCTGATGGACTGACTTCCGATCAATAGGTTTGATGGCCTTAGCAGGTTCTGTACTAGAGAAATCA-ATTT is described in ClinVar as [Pathogenic]. Clinvar id is 91341.Status of the report is reviewed_by_expert_panel, 3 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
PMS2	NM_000535.7	c.24-12_107delinsAAAT		splice_acceptor_variant, coding_sequence_variant, intron_variant	2/15	ENST00000265849.12	NP_000526.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
PMS2	ENST00000265849.12	c.24-12_107delinsAAAT		splice_acceptor_variant, coding_sequence_variant, intron_variant	2/15	1	NM_000535.7	ENSP00000265849	P3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:7

Revision: reviewed by expert panel

Submissions by phenotype

not provided Pathogenic:2

Pathogenic, criteria provided, single submitter	clinical testing	Revvity Omics, Revvity	Nov 15, 2022	- -
Pathogenic, criteria provided, single submitter	clinical testing	GeneDx	Jan 24, 2022	Variant involving a canonical splice site reported to result in skipping of exon 2 leading to a null allele in a gene for which loss-of-function is a known mechanism of disease (van der Klift 2010); Observed in individuals with Lynch syndrome (van der Klift 2010, ten Broeke 2015, Suerink 2016); Not observed at significant frequency in large population cohorts (gnomAD); Truncating variants in this gene are considered pathogenic by a well-established clinical consortium and/or database; This variant is associated with the following publications: (PMID: 20186688, 25512458, 26110232) -

Lynch syndrome 4 Pathogenic:2

Pathogenic, criteria provided, single submitter	clinical testing	Baylor Genetics	Apr 29, 2022	- -
Likely pathogenic, criteria provided, single submitter	clinical testing	Myriad Genetics, Inc.	Sep 18, 2023	This variant is considered likely pathogenic. This variant occurs within a consensus splice junction and is predicted to result in abnormal mRNA splicing of either an out-of-frame exon or an in-frame exon necessary for protein stability and/or normal function. -

Lynch syndrome Pathogenic:1

Pathogenic, reviewed by expert panel

research

International Society for Gastrointestinal Hereditary Tumours (InSiGHT)

Sep 05, 2013

Coding sequence variation resulting in a stop codon (also interrupts canonical acceptor splice site) -

Hereditary nonpolyposis colorectal neoplasms Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Dec 13, 2023

This variant results in the deletion of part of exon 2 (c.24-12_107delinsAAAT) of the PMS2 gene. RNA analysis indicates that this variant induces altered splicing and may result in an absent or disrupted protein product. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with clinical features of Lynch syndrome (PMID: 20186688). ClinVar contains an entry for this variant (Variation ID: 91341). Studies have shown that this variant results in skipping of exon 2 and introduces a premature termination codon (PMID: 20186688; Invitae). The resulting mRNA is expected to undergo nonsense-mediated decay. For these reasons, this variant has been classified as Pathogenic. -

Hereditary cancer-predisposing syndrome Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Ambry Genetics

Jul 14, 2022

The c.24-12_107del96insAAAT pathogenic mutation, located in intron 1 and coding exon 2 of the PMS2 gene, results from the deletion of 96 nucleotides and insertion of 4 nucleotides at positions c.24-12 to c.107. RT-PCR analysis demonstrated that this alteration results in out of frame exon skipping (van der Klift HM et al. Hum. Mutat. 2010 May;31(5):578-87). In addition, this alteration was identified in patients with colorectal cancer, as well as in two siblings with congenital mismatch repair deficiency (CMMR-D) who were positive for a second PMS2 mutation in trans (van der Klift HM et al. Hum. Mutat. 2010 May;31(5):578-87; Bougeard G et al. Fam. Cancer. 2014 Mar;13(1):131-5). In silico splice site analysis predicts that this alteration may weaken the native splice acceptor site; however, direct evidence is insufficient at this time (Ambry internal data). In addition to the clinical data presented in the literature, alterations that disrupt the canonical splice site are expected to cause aberrant splicing, resulting in an abnormal protein or a transcript that is subject to nonsense-mediated mRNA decay. As such, this alteration is classified as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554306445; hg19: chr7-6045579;