7-94421772-CCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA-CCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTACTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA

Variant names:

• chr7-94421772-C-CCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA
• rs3216902
• NM_000089.4:c.2350-124_2350-87dupACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTACT

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_000089.4(COL1A2):​c.2350-124_2350-87dupACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTACT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 24)
• Consequence: COL1A2 NM_000089.4 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.0590
• Publications: 3 publications found

Genes affected

COL1A2 (HGNC:2198): (collagen type I alpha 2 chain) This gene encodes the pro-alpha2 chain of type I collagen whose triple helix comprises two alpha1 chains and one alpha2 chain. Type I is a fibril-forming collagen found in most connective tissues and is abundant in bone, cornea, dermis and tendon. Mutations in this gene are associated with osteogenesis imperfecta types I-IV, Ehlers-Danlos syndrome type VIIB, recessive Ehlers-Danlos syndrome Classical type, idiopathic osteoporosis, and atypical Marfan syndrome. Symptoms associated with mutations in this gene, however, tend to be less severe than mutations in the gene for the alpha1 chain of type I collagen (COL1A1) reflecting the different role of alpha2 chains in matrix integrity. Three transcripts, resulting from the use of alternate polyadenylation signals, have been identified for this gene. [provided by R. Dalgleish, Feb 2008]

COL1A2 Gene-Disease associations (from GenCC):

• Ehlers-Danlos syndrome, arthrochalasia type, 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Illumina, PanelApp Australia, Labcorp Genetics (formerly Invitae)
• osteogenesis imperfecta

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• osteogenesis imperfecta type 1

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• osteogenesis imperfecta type 2

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P, ClinGen
• osteogenesis imperfecta type 3

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, ClinGen
• osteogenesis imperfecta type 4

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• Ehlers-Danlos syndrome, arthrochalasia type

  Inheritance: AR, AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, ClinGen
• Ehlers-Danlos syndrome, cardiac valvular type

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, ClinGen, PanelApp Australia, Orphanet, G2P
• combined osteogenesis imperfecta and Ehlers-Danlos syndrome 2

  Inheritance: AD Classification: MODERATE Submitted by: ClinGen, Ambry Genetics
• Ehlers-Danlos/osteogenesis imperfecta syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• high bone mass osteogenesis imperfecta

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
COL1A2	NM_000089.4	c.2350-124_2350-87dupACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTACT		intron_variant	Intron 38 of 51	ENST00000297268.11	NP_000080.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
COL1A2	ENST00000297268.11	c.2350-127_2350-126insCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA		intron_variant	Intron 38 of 51	1	NM_000089.4	ENSP00000297268.6
COL1A2	ENST00000473573.5	n.687-127_687-126insCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA		intron_variant	Intron 10 of 10	2
COL1A2	ENST00000497316.5	n.747-127_747-126insCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA		intron_variant	Intron 7 of 8	2

Frequencies

GnomAD3 genomes Cov.: 24

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 24

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.059

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3216902; hg19: chr7-94051084;