rs3216902

chr7-94421772-CCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA-Cchr7-94421772-CCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA-CCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTACTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA

Variant summary

Our verdict is Benign. Variant got -10 ACMG points: 0P and 10B. BP6_Moderate BA1

The NM_000089.4(COL1A2):c.2350-124_2350-87del variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.362 in 1,160,680 control chromosomes in the GnomAD database, including 64,998 homozygotes. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.24 (5245 hom., cov: 24)
  • Exomes 𝑓: 0.38 (59753 hom.)
• Consequence: COL1A2 NM_000089.4 intron
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.20

Genes affected

COL1A2 (HGNC:2198): (collagen type I alpha 2 chain) This gene encodes the pro-alpha2 chain of type I collagen whose triple helix comprises two alpha1 chains and one alpha2 chain. Type I is a fibril-forming collagen found in most connective tissues and is abundant in bone, cornea, dermis and tendon. Mutations in this gene are associated with osteogenesis imperfecta types I-IV, Ehlers-Danlos syndrome type VIIB, recessive Ehlers-Danlos syndrome Classical type, idiopathic osteoporosis, and atypical Marfan syndrome. Symptoms associated with mutations in this gene, however, tend to be less severe than mutations in the gene for the alpha1 chain of type I collagen (COL1A1) reflecting the different role of alpha2 chains in matrix integrity. Three transcripts, resulting from the use of alternate polyadenylation signals, have been identified for this gene. [provided by R. Dalgleish, Feb 2008]

ACMG classification

Verdict is Benign. Variant got -10 ACMG points.

• BP6: Variant 7-94421772-CCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA-C is Benign according to our data. Variant chr7-94421772-CCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA-C is described in ClinVar as [Benign]. Clinvar id is 1253038.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (NFE) allele frequency at 95% confidence interval = 0.307 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
COL1A2	NM_000089.4	c.2350-124_2350-87del		intron_variant		ENST00000297268.11

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
COL1A2	ENST00000297268.11	c.2350-124_2350-87del		intron_variant		1	NM_000089.4	P1
COL1A2	ENST00000473573.5	n.687-124_687-87del		intron_variant, non_coding_transcript_variant		2
COL1A2	ENST00000497316.5	n.747-124_747-87del		intron_variant, non_coding_transcript_variant		2

Frequencies

GnomAD3 genomes AF: 0.237 AC: 35891 AN: 151702 Hom.: 5247 Cov.: 24

Gnomad AFR AF: 0.0611

Gnomad AMI AF: 0.279

Gnomad AMR AF: 0.255

Gnomad ASJ AF: 0.282

Gnomad EAS AF: 0.255

Gnomad SAS AF: 0.277

Gnomad FIN AF: 0.378

Gnomad MID AF: 0.252

Gnomad NFE AF: 0.311

Gnomad OTH AF: 0.231

GnomAD4 exome AF: 0.381 AC: 384410 AN: 1008860 Hom.: 59753 AF XY: 0.375 AC XY: 194608 AN XY: 519088

Gnomad4 AFR exome AF: 0.0733

Gnomad4 AMR exome AF: 0.261

Gnomad4 ASJ exome AF: 0.318

Gnomad4 EAS exome AF: 0.274

Gnomad4 SAS exome AF: 0.314

Gnomad4 FIN exome AF: 0.376

Gnomad4 NFE exome AF: 0.415

Gnomad4 OTH exome AF: 0.339

GnomAD4 genome AF: 0.236 AC: 35877 AN: 151820 Hom.: 5245 Cov.: 24 AF XY: 0.241 AC XY: 17853 AN XY: 74170

Gnomad4 AFR AF: 0.0609

Gnomad4 AMR AF: 0.255

Gnomad4 ASJ AF: 0.282

Gnomad4 EAS AF: 0.255

Gnomad4 SAS AF: 0.276

Gnomad4 FIN AF: 0.378

Gnomad4 NFE AF: 0.311

Gnomad4 OTH AF: 0.228

Alfa AF: 0.256 Hom.: 604

Asia WGS AF: 0.232 AC: 806 AN: 3478

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Benign, criteria provided, single submitter

clinical testing

GeneDx

Jun 28, 2018

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3216902; hg19: chr7-94051084;